View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11470_high_55 (Length: 226)
Name: NF11470_high_55
Description: NF11470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11470_high_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 41 - 141
Target Start/End: Complemental strand, 41828590 - 41828490
Alignment:
| Q |
41 |
tcacatgatggaaattgaatgaagtgaaggttaacagcaatccagctagtgtgctatcaattcatggttgatgtcttggtttcctagtttggtttggttt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
41828590 |
tcacatgatggaaattgaatgaagtgaaggttaacagtaatccagctagtgtgctatcaattcatggttgatgtcttagtttcctagttaggtttggttt |
41828491 |
T |
 |
| Q |
141 |
g |
141 |
Q |
| |
|
| |
|
|
| T |
41828490 |
g |
41828490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University