View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11470_high_58 (Length: 206)

Name: NF11470_high_58
Description: NF11470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11470_high_58
NF11470_high_58
[»] chr5 (1 HSPs)
chr5 (18-189)||(35003937-35004108)


Alignment Details
Target: chr5 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 35004108 - 35003937
Alignment:
18 cacagatggatatcttttggttcacgccaatggaggattaaatcaaatgaaaaccggagtaagtatgcagttataaattgctcatttttatttatcataa 117  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
35004108 cacaaatggatatcttttggttcacgccaatggaggattaaatcaaatgaaaaccggagtaagtatgcagttataaattgctaatttttatttatcataa 35004009  T
118 tttaacttttgcttaaacataatttttgtgagaataaatatagttttcatcatattgcagataagcgacatg 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35004008 tttaacttttgcttaaacataatttttgtgagaataaatatagttttcatcatattgcagataagcgacatg 35003937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University