View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11470_low_21 (Length: 431)

Name: NF11470_low_21
Description: NF11470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11470_low_21
NF11470_low_21
[»] chr7 (9 HSPs)
chr7 (30-401)||(21780753-21781124)
chr7 (32-361)||(18341762-18342079)
chr7 (28-207)||(38705830-38706009)
chr7 (32-239)||(7305962-7306169)
chr7 (31-242)||(19764281-19764492)
chr7 (32-163)||(41201781-41201912)
chr7 (31-128)||(7916207-7916305)
chr7 (32-108)||(1534009-1534086)
chr7 (32-124)||(23769334-23769427)
[»] chr8 (7 HSPs)
chr8 (30-358)||(16375662-16376001)
chr8 (30-366)||(9763183-9763530)
chr8 (32-242)||(11722519-11722729)
chr8 (276-341)||(16375597-16375662)
chr8 (30-107)||(35631423-35631501)
chr8 (32-100)||(44462714-44462783)
chr8 (32-100)||(44470245-44470314)
[»] chr2 (8 HSPs)
chr2 (32-399)||(7094563-7094941)
chr2 (30-242)||(11882075-11882287)
chr2 (32-240)||(37393131-37393339)
chr2 (32-158)||(35593211-35593337)
chr2 (32-158)||(4968993-4969119)
chr2 (92-195)||(40654247-40654349)
chr2 (32-124)||(1696879-1696972)
chr2 (32-124)||(33058024-33058117)
[»] scaffold0214 (1 HSPs)
scaffold0214 (32-364)||(123-456)
[»] chr6 (9 HSPs)
chr6 (32-366)||(4968258-4968603)
chr6 (31-361)||(28679081-28679395)
chr6 (30-207)||(13507541-13507718)
chr6 (51-204)||(4449126-4449279)
chr6 (32-163)||(13338047-13338178)
chr6 (32-163)||(28902826-28902957)
chr6 (32-118)||(31519894-31519981)
chr6 (32-128)||(17311421-17311518)
chr6 (31-101)||(20106165-20106236)
[»] scaffold1414 (1 HSPs)
scaffold1414 (32-361)||(1161-1493)
[»] chr5 (3 HSPs)
chr5 (30-207)||(33891810-33891987)
chr5 (30-207)||(37574807-37574972)
chr5 (72-163)||(2063564-2063654)
[»] chr1 (4 HSPs)
chr1 (32-242)||(34678535-34678745)
chr1 (32-276)||(20338780-20339024)
chr1 (35-207)||(49329430-49329602)
chr1 (32-128)||(2399567-2399664)
[»] scaffold0260 (1 HSPs)
scaffold0260 (32-276)||(1103-1347)
[»] chr4 (6 HSPs)
chr4 (33-242)||(16924321-16924530)
chr4 (116-206)||(38973288-38973378)
chr4 (92-242)||(32215122-32215271)
chr4 (32-128)||(5322641-5322739)
chr4 (30-89)||(38973368-38973427)
chr4 (31-94)||(20361018-20361082)
[»] scaffold0669 (1 HSPs)
scaffold0669 (31-158)||(6782-6909)
[»] chr3 (8 HSPs)
chr3 (31-158)||(33908833-33908960)
chr3 (30-163)||(18554330-18554463)
chr3 (31-163)||(23702319-23702451)
chr3 (31-163)||(23720775-23720907)
chr3 (31-163)||(23739231-23739363)
chr3 (45-128)||(20850223-20850307)
chr3 (32-128)||(6305834-6305931)
chr3 (77-106)||(46830182-46830211)
[»] scaffold0573 (1 HSPs)
scaffold0573 (32-163)||(6837-6968)
[»] scaffold1371 (1 HSPs)
scaffold1371 (32-108)||(1822-1899)


Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 9)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 30 - 401
Target Start/End: Complemental strand, 21781124 - 21780753
Alignment:
Q  30 aacactacaagaataatgaccttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataa 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||| ||    
T  21781124 aacactacaagaataatgaccttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcagaa 21781025  T
Q  130 aagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcag 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| |||||||| ||||||||| |  ||||||||    
T  21781024 aagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgggagtttgaaaatccaaaagctgaaggaatctctactgtgtcag 21780925  T
Q  230 agaaaaccgacggcttctgccaaggatgcgcccttcggatgcgcaaatgtcagcctttttccggttgacttgacaaggtactgggaaagctggtccgttg 329  Q
    |||||||||||||||| ||||| || |  |||| ||||||||||||||| ||| |||||||||||||| |||||||||  ||||||||||||||||||||    
T  21780924 agaaaaccgacggcttatgccagggctttgcccctcggatgcgcaaatggcaggctttttccggttgagttgacaaggcgctgggaaagctggtccgttg 21780825  T
Q  330 caggcctgccaggggctaaacgcctcgcaaattgcagcacgcccacgctttttccctcccgttttgtgcctc 401  Q
    ||||||||||||||||||||| ||||| ||||||||||  |||  |||||||||||| ||||| || |||||    
T  21780824 caggcctgccaggggctaaacccctcggaaattgcagctagccgtcgctttttccctgccgttctgcgcctc 21780753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 32 - 361
Target Start/End: Complemental strand, 18342079 - 18341762
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaaa 131  Q
    |||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||            |||||||||||| ||||    
T  18342079 cactacaagaataatagccttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccaggga------------caaccgctggcaaaaaa 18341992  T
Q  132 gacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcagag 231  Q
    |||||||||||||||||||||||||||||||||| | |||||||||||||||||  ||||||||||| |||||||| ||||||||| || ||||||||||    
T  18341991 gacagggactttgcccctcgttttttgtaaaatgccctggcttttgtttaggcgggagtttgaaaatccaaaagctgaaggaatctctgctgtgtcagag 18341892  T
Q  232 aaaaccgacggcttctgccaaggatgcgcccttcggatgcgcaaatgtcagcctttttccggttgacttgacaaggtactgggaaagctggtccgttgca 331  Q
    |||||||||| ||| ||||| || |  |||| ||||||||||||||  ||| |||||||||||||| |||||||||  ||||||||||  ||| ||||||    
T  18341891 aaaaccgacgacttatgccagggctttgcccctcggatgcgcaaattgcaggctttttccggttgagttgacaaggcgctgggaaagcgtgtctgttgca 18341792  T
Q  332 ggcctgccaggggctaaacgcctcgcaaat 361  Q
    ||| ||||||||||||||| ||||| ||||    
T  18341791 ggcgtgccaggggctaaacccctcggaaat 18341762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 28 - 207
Target Start/End: Complemental strand, 38706009 - 38705830
Alignment:
Q  28 tgaacactacaagaataatgaccttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcat 127  Q
    |||||||||||||||  ||  | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||     
T  38706009 tgaacactacaagaaacattgcgttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcaa 38705910  T
Q  128 aaaagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagct 207  Q
    ||||| ||||||||||||||||||||||||||  || | ||||||     ||||||||||||||||||| ||||||||||    
T  38705909 aaaagccagggactttgcccctcgttttttgtccaaagacgtggcaaacatttaggcgccagtttgaaatttcaaaagct 38705830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 32 - 239
Target Start/End: Complemental strand, 7306169 - 7305962
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    ||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |  |||| ||||| ||||| |||    
T  7306169 cactacaagaataatgaccatttgccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa 7306070  T
Q  131 agacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcaga 230  Q
    ||||||||| ||||||||||| ||||||  |||   ||| | | || ||||||||||||||||||  || |||| || | ||||||| || | |||||||    
T  7306069 agacaggga-tttgcccctcgctttttgccaaaatccgtcggtattttttaggcgccagtttgaattttgaaaatctgagggaatctctgctatgtcaga 7305971  T
Q  231 gaaaaccga 239  Q
    |||||||||    
T  7305970 gaaaaccga 7305962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 31 - 242
Target Start/End: Complemental strand, 19764492 - 19764281
Alignment:
Q  31 acactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataa 129  Q
    ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||||||| |  |||| ||||| ||||| ||    
T  19764492 acactacaagaataatgaccttttgccagggattttgacaagggtttgaaacccctggcaaatttgacagggaaaataccaaggaaaaccggtggcacaa 19764393  T
Q  130 aagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcag 229  Q
    |||||||||| ||||||||||| ||||||  |||   | | | |||| |||||||||||| |||||  || |||| || | ||||||| || | ||||||    
T  19764392 aagacaggga-tttgcccctcgctttttgccaaaatccctcggttttttttaggcgccagattgaatttttaaaatctgagggaatctctgctatgtcag 19764294  T
Q  230 agaaaaccgacgg 242  Q
    |||||||||||||    
T  19764293 agaaaaccgacgg 19764281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 32 - 163
Target Start/End: Complemental strand, 41201912 - 41201781
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    ||||||||||||| | |||||||||||||||||||| ||||| |||||| |||||||||||||| |||||||||||||  ||||||| |||||||| |||    
T  41201912 cactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaattttccagggaaaatgccaaggacaatcgctggcaaaaa 41201813  T
Q  131 agacagggactttgcccctcgttttttgtaaaa 163  Q
    | || |||  |||||||||||||| || |||||    
T  41201812 acactggg-gtttgcccctcgtttattttaaaa 41201781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 31 - 128
Target Start/End: Original strand, 7916207 - 7916305
Alignment:
Q  31 acactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcata 128  Q
    ||||||||||||  ||||| |||| |||||||||||| || || |||| ||||||||||||||||||||||||||||||  ||||||||  ||||||||    
T  7916207 acactacaagaaatatgacattttaccagggattttgacaggggtttggaacccctggcaaatttgccagggaaaatgccaaggacaacacctggcata 7916305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 32 - 108
Target Start/End: Original strand, 1534009 - 1534086
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaaggtt-tgaaacccctggcaaatttgccagggaaaatgc 108  Q
    ||||||||||| ||||  | ||||||| |||||||| || ||   |||||||||||||||||||||||||||||||||    
T  1534009 cactacaagaaaaatgcacatttgccaaggattttgacagggacatgaaacccctggcaaatttgccagggaaaatgc 1534086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 32 - 124
Target Start/End: Original strand, 23769334 - 23769427
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctgg 124  Q
    |||||||||||  || |||||||||||||||||||| || || ||| |||||||||| |||| | ||| |||||||||  ||||||||| ||||    
T  23769334 cactacaagaaacattaccttttgccagggattttgacagggttttaaaacccctggtaaatataccacggaaaatgccaaggacaacccctgg 23769427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 30 - 358
Target Start/End: Complemental strand, 16376001 - 16375662
Alignment:
Q  30 aacactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcata 128  Q
    |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||  |||||||||| |||||||    
T  16376001 aacactgcaagaataatgaccttttgccagggattttgtcaagggtttgaaacccctggcaaatttgccagggaaaatgccaaggacaaccgttggcata 16375902  T
Q  129 aaagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtca 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||    
T  16375901 aaagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctgaaggaatctctgctgtgtca 16375802  T
Q  229 gagaaaaccgacggcttctgccaaggatgcgcccttcggatgcgca----------aatgtcagcctttttccggttgacttgacaaggtactgggaaag 318  Q
    ||||||||| |||||||||||||||||||||||| |||||||||||          ||||||| ||||||||||||||||||||||||| ||||||||||    
T  16375801 gagaaaaccaacggcttctgccaaggatgcgcccctcggatgcgcaaaattcaaagaatgtcatcctttttccggttgacttgacaaggcactgggaaag 16375702  T
Q  319 ctggtccgttgcaggcctgccaggggctaaacgcctcgca 358  Q
    ||||||||||||||||||||||| |||||||| |||||||    
T  16375701 ctggtccgttgcaggcctgccagaggctaaacacctcgca 16375662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 30 - 366
Target Start/End: Original strand, 9763183 - 9763530
Alignment:
Q  30 aacactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcata 128  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |||||||||  ||||||||||||||||||    
T  9763183 aacactacaagaataatgaccttttgccagggattttgtcaagggtttgaaacccttggcaaatttgccaaggaaaatgccaaggacaaccgctggcata 9763282  T
Q  129 aaagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtca 228  Q
    |||||| |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||| || |||||||    
T  9763283 aaagacggggactttgcccctcgttttttgtaaaatgccgtggctttagtttaggcgccagtttgaaaattcaaaagctgaaggaatctctgctgtgtca 9763382  T
Q  229 gagaaaaccgacggcttctgccaaggatgcgcccttcggatgcgc----------aaatgtcagcctttttccggttgacttgacaaggtactgggaaag 318  Q
    ||||||||||||||||| ||||| |||||| ||| ||||||||||           ||||||||||||||||| |||||||||||||||  |||||||||    
T  9763383 gagaaaaccgacggcttatgccagggatgcacccctcggatgcgcgaaattcaaagaatgtcagcctttttcctgttgacttgacaagggtctgggaaag 9763482  T
Q  319 ctggtccgttgcaggcctgccaggggctaaacgcctcgcaaattgcag 366  Q
    |||||||||||||||||||||| ||||||||| ||||||  |||||||    
T  9763483 ctggtccgttgcaggcctgccacgggctaaacccctcgcttattgcag 9763530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 32 - 242
Target Start/End: Complemental strand, 11722729 - 11722519
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |  |||| ||||  ||||| |||    
T  11722729 cactacaagaataatgaccttttgccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccagtggcacaaa 11722630  T
Q  131 agacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcaga 230  Q
    ||||||||| ||||||||||| ||||||  |||   | | |||||| |||||||||||| |||||  || |||| || | ||||||||   | |||||||    
T  11722629 agacaggga-tttgcccctcgctttttgccaaaatccctcgcttttttttaggcgccagattgaatttttaaaatctgagggaatcttatctatgtcaga 11722531  T
Q  231 gaaaaccgacgg 242  Q
    ||||||||||||    
T  11722530 gaaaaccgacgg 11722519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 276 - 341
Target Start/End: Complemental strand, 16375662 - 16375597
Alignment:
Q  276 atgtcagcctttttccggttgacttgacaaggtactgggaaagctggtccgttgcaggcctgccag 341  Q
    |||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||    
T  16375662 atgtcagccttttttcgattgacttgacaaggcactgggaaagctggtccgttgcaggcctgccag 16375597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 30 - 107
Target Start/End: Complemental strand, 35631501 - 35631423
Alignment:
Q  30 aacactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatg 107  Q
    |||||||||||||  || ||| |||||||| ||||||| || || |||||||||||||| |||||| ||||||||||||    
T  35631501 aacactacaagaaacattaccatttgccagagattttgacaggggtttgaaacccctggaaaatttaccagggaaaatg 35631423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 32 - 100
Target Start/End: Original strand, 44462714 - 44462783
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagg 100  Q
    |||||||||||||||| || |||||||||||||||| |||||   |||||||||||| |||||| |||||    
T  44462714 cactacaagaataatgcccatttgccagggattttgacaaggacatgaaacccctgggaaattttccagg 44462783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 32 - 100
Target Start/End: Original strand, 44470245 - 44470314
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagg 100  Q
    |||||||||||||||| || |||||||||||||||| |||||   |||||||||||| |||||| |||||    
T  44470245 cactacaagaataatgcccatttgccagggattttgacaaggacatgaaacccctgggaaattttccagg 44470314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 32 - 399
Target Start/End: Complemental strand, 7094941 - 7094563
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    ||||||||||||||||||||||||||||  |||||||||||| |||||||||||||||||||||||||||||||||||  ||||||||||||||||||||    
T  7094941 cactacaagaataatgaccttttgccagaaattttgtcaagggtttgaaacccctggcaaatttgccagggaaaatgccaaggacaaccgctggcataaa 7094842  T
Q  131 agacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcaga 230  Q
    ||||||||||||||||||||| ||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||| ||||||||| || ||||| |||    
T  7094841 agacagggactttgcccctcgctttttgtaaaatgtcgtggttttagtttaggcgccagtttgaaaattcaaaagctgaaggaatctctgctgtgttaga 7094742  T
Q  231 gaaaaccgacggcttctgccaaggatgcgcccttcggatgcgcaaa----------tgtcagcctttttccggttgacttgacaaggtactgggaaagct 320  Q
    |||||||||| |||| ||||| |||||||||| |||||||||||||          |||||||| |||||| |||||||||||||||  |||||||||||    
T  7094741 gaaaaccgacagcttatgccagggatgcgcccctcggatgcgcaaaattcaaagattgtcagccattttcctgttgacttgacaagggcctgggaaagct 7094642  T
Q  321 ggtccgttgcaggcctgccaggggctaaacgcctcgcaaattgcagcacgcccacgctttttccctcccgttttgtgcc 399  Q
    |||||||||||||||||||||||||||||| ||||||  ||||||| | |||| |||||||| |  |||||| ||||||    
T  7094641 ggtccgttgcaggcctgccaggggctaaacccctcgcttattgcagtatgccctcgctttttgcaacccgttatgtgcc 7094563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 30 - 242
Target Start/End: Complemental strand, 11882287 - 11882075
Alignment:
Q  30 aacactacaagaataatgaccttttgccagggattttgtcaa-ggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcata 128  Q
    |||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||| |||||||||| |  |||| ||| | ||||| |    
T  11882287 aacactacaagaataatgaccttttgccagggattttgacaagggtttgatacccctggcaaatttgtcagggaaaataccaaggaaaactggtggcaca 11882188  T
Q  129 aaagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtca 228  Q
    ||||||||||| ||||||||||| ||||||| |||   | |||||||  ||||||||||||||||||  || |||| |||| ||||||| || | |||||    
T  11882187 aaagacaggga-tttgcccctcgctttttgtcaaaatccctggctttattttaggcgccagtttgaattttgaaaatctaagggaatctctgctatgtca 11882089  T
Q  229 gagaaaaccgacgg 242  Q
    ||||||||||||||    
T  11882088 gagaaaaccgacgg 11882075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 32 - 240
Target Start/End: Complemental strand, 37393339 - 37393131
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    ||||||||||||||||||||||||||| |||||||| ||||| ||||| ||||||||||||||||||||||||||| |  |||| ||||| ||||| |||    
T  37393339 cactacaagaataatgaccttttgccaaggattttgacaagggtttgatacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa 37393240  T
Q  131 agacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcaga 230  Q
    ||||||||| ||||||||||| ||||||| |||   | |||||||  |||||||||||| |||||  || |||| |||| ||||||| || | |||||||    
T  37393239 agacaggga-tttgcccctcgctttttgtcaaaatccctggctttattttaggcgccagattgaattttgaaaatctaagggaatctctgctatgtcaga 37393141  T
Q  231 gaaaaccgac 240  Q
    ||||||||||    
T  37393140 gaaaaccgac 37393131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 32 - 158
Target Start/End: Original strand, 35593211 - 35593337
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    ||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |  |||| ||||| ||||| |||    
T  35593211 cactacaagaataatgaccctttgccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa 35593310  T
Q  131 agacagggactttgcccctcgttttttg 158  Q
    ||||||||| ||||||||||| ||||||    
T  35593311 agacaggga-tttgcccctcgctttttg 35593337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 32 - 158
Target Start/End: Complemental strand, 4969119 - 4968993
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    ||||||||||||||||||| |||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||| |  |||| ||||| ||||| |||    
T  4969119 cactacaagaataatgaccctttgccagagattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa 4969020  T
Q  131 agacagggactttgcccctcgttttttg 158  Q
    ||||||||| ||||||||||| ||||||    
T  4969019 agacaggga-tttgcccctcgctttttg 4968993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 92 - 195
Target Start/End: Original strand, 40654247 - 40654349
Alignment:
Q  92 tttgccagggaaaatgcacaggacaaccgctggcataaaagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtt 191  Q
    ||||||||||||||| |  |||| ||||| ||||| |||||||||||| ||||||||||| ||||||  |||   ||| | |||| ||||||||||||||    
T  40654247 tttgccagggaaaataccaaggaaaaccggtggcacaaaagacaggga-tttgcccctcgctttttgccaaaatccgtcggttttttttaggcgccagtt 40654345  T
Q  192 tgaa 195  Q
    ||||    
T  40654346 tgaa 40654349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 32 - 124
Target Start/End: Original strand, 1696879 - 1696972
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctgg 124  Q
    |||||||||||  || |||||||||||||||||||| || || ||| |||||||||| |||| | ||| |||||||||  ||||||||| ||||    
T  1696879 cactacaagaaacattaccttttgccagggattttgacagggttttaaaacccctggtaaatataccacggaaaatgccaaggacaacccctgg 1696972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 32 - 124
Target Start/End: Complemental strand, 33058117 - 33058024
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctgg 124  Q
    |||||||||||  || |||||||||||||||||||| || || ||| |||||||||| |||| | ||| |||||||||  ||||||||| ||||    
T  33058117 cactacaagaaacattaccttttgccagggattttgacagggttttaaaacccctggtaaatataccacggaaaatgccaaggacaacccctgg 33058024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0214 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0214
Description:

Target: scaffold0214; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 32 - 364
Target Start/End: Complemental strand, 456 - 123
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaaa 131  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||| ||||    
T  456 cactacaagaataatggccttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcaaaaaa 357  T
Q  132 gacagggactttgcccctcgttttttgt-aaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcaga 230  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||  | ||||||||| |||||||| ||||||||| || |||||||||    
T  356 gacagggactttgcccctcgttttttgtaaaaatggcgtggcttttgtttaggcgggattttgaaaatccaaaagctgaaggaatctctggtgtgtcaga 257  T
Q  231 gaaaaccgacggcttctgccaaggatgcgcccttcggatgcgcaaatgtcagcctttttccggttgacttgacaaggtactgggaaagctggtccgttgc 330  Q
    ||||||||||||||| ||||| || |  |||| ||||||||| ||||  ||| |||||||||||||| |||||||||  ||||||||||  ||  | |||    
T  256 gaaaaccgacggcttatgccagggctttgcccctcggatgcgtaaattgcaggctttttccggttgagttgacaaggcgctgggaaagcgtgtatgctgc 157  T
Q  331 aggcctgccaggggctaaacgcctcgcaaattgc 364  Q
    |||| ||||||||||||||| ||||| |||||||    
T  156 aggcgtgccaggggctaaacccctcggaaattgc 123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 191; Significance: 1e-103; HSPs: 9)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 32 - 366
Target Start/End: Original strand, 4968258 - 4968603
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||  |||| |||||||| ||||||    
T  4968258 cactacaagaataatgaccttttgccagggattttgtcaagggtttgaaacccctcgcaaatttgccagggaaaatgccaaggagaaccgctgacataaa 4968357  T
Q  131 agacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcaga 230  Q
    ||||| ||| ||||||||||||||||||||||||| | ||| ||| |||||||||||||||| |||||||||||||| ||||||||| || |||||||||    
T  4968358 agacatggattttgcccctcgttttttgtaaaatgccctggttttagtttaggcgccagtttaaaaattcaaaagctgaaggaatctctgctgtgtcaga 4968457  T
Q  231 gaaaaccgacggcttctgccaaggatgcgcccttcggatgcgcaaa----------tgtcagcctttttccggttgacttgacaaggtactgggaaagct 320  Q
    ||||||||||||||| ||||| ||||| |||| ||||||| |||||          |||||||| |||||| |||||||||||||||  |||||||||||    
T  4968458 gaaaaccgacggcttatgccagggatgtgcccctcggatgtgcaaaattcaaagattgtcagccattttcctgttgacttgacaagggcctgggaaagct 4968557  T
Q  321 ggtccgttgcaggcctgccaggggctaaacgcctcgcaaattgcag 366  Q
    ||||||||||||| || ||||||||||||| ||||||| |||||||    
T  4968558 ggtccgttgcaggtctaccaggggctaaacccctcgcatattgcag 4968603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 31 - 361
Target Start/End: Original strand, 28679081 - 28679395
Alignment:
Q  31 acactacaagaataatgaccttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    ||||||||            ||||| |||||| |||    
T  28679081 acactacaagaataatggccttttgccagggattttgtcaaggtttgaaacccctggcaa----gccaggga------------caacctctggcaaaaa 28679164  T
Q  131 agacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcaga 230  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||  ||||||||||| |||||||| ||||||||| || |||||||||    
T  28679165 agacagggactttgcccctcgttttttgtaaaatgccgtggcttttgtttaggcgggagtttgaaaatccaaaagctgaaggaatctctgctgtgtcaga 28679264  T
Q  231 gaaaaccgacggcttctgccaaggatgcgcccttcggatgcgcaaatgtcagcctttttccggttgacttgacaaggtactgggaaagctggtccgttgc 330  Q
    ||||||||||||||| ||||| || |  |||| ||||||||||||||  ||| ||||| |||||||| |||||||||  ||||||||||  ||| |||||    
T  28679265 gaaaaccgacggcttatgccagggctttgcccctcggatgcgcaaattgcaggcttttaccggttgagttgacaaggcgctgggaaagcgtgtctgttgc 28679364  T
Q  331 aggcctgccaggggctaaacgcctcgcaaat 361  Q
    |||| ||||||||||||||| ||||| ||||    
T  28679365 aggcgtgccaggggctaaacccctcggaaat 28679395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 30 - 207
Target Start/End: Original strand, 13507541 - 13507718
Alignment:
Q  30 aacactacaagaataatgaccttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataa 129  Q
    |||||||||||||  ||  | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||| ||    
T  13507541 aacactacaagaaacattgcgttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcaaaa 13507640  T
Q  130 aagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagct 207  Q
    ||| ||||||||||||||||||||||||||  || | ||||||     ||||||||||||||||||| ||||||||||    
T  13507641 aagccagggactttgcccctcgttttttgtccaaagccgtggcaaacatttaggcgccagtttgaaatttcaaaagct 13507718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 51 - 204
Target Start/End: Complemental strand, 4449279 - 4449126
Alignment:
Q  51 ttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaaagacagggactttgcccctc 150  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||| ||||| |||||||||||||||||    
T  4449279 ttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcaaaaaagccagggactttgcccctc 4449180  T
Q  151 gttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaa 204  Q
    ||||||||| ||| | ||||||     |||||||||||| |||||| |||||||    
T  4449179 gttttttgtcaaaagccgtggcaaacatttaggcgccagattgaaatttcaaaa 4449126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 32 - 163
Target Start/End: Complemental strand, 13338178 - 13338047
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    ||||||||||||| | ||||||||||| |||||||| ||||| |||||| ||||||||||||||||||||||||||||  |||||||||||||||| |||    
T  13338178 cactacaagaatagttaccttttgccaaggattttgacaagggtttgaagcccctggcaaatttgccagggaaaatgccaaggacaaccgctggcaaaaa 13338079  T
Q  131 agacagggactttgcccctcgttttttgtaaaa 163  Q
    | || |||  |||||||||||||| || |||||    
T  13338078 acactggg-gtttgcccctcgtttattttaaaa 13338047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 32 - 163
Target Start/End: Original strand, 28902826 - 28902957
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    ||||||||||||| | |||||||||||||||||||| ||||| |||||| ||||||||||||||| ||||||||||||  |||||||||||||||| |||    
T  28902826 cactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaatttgtcagggaaaatgccaaggacaaccgctggcaaaaa 28902925  T
Q  131 agacagggactttgcccctcgttttttgtaaaa 163  Q
    | || |||  |||||||||||||| || |||||    
T  28902926 acactggg-gtttgcccctcgtttattttaaaa 28902957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 32 - 118
Target Start/End: Original strand, 31519894 - 31519981
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaac 118  Q
    |||||||||||  ||||| ||||||||||||||||| || || |||| ||||||||||||||||||||||||||||||  ||||||||    
T  31519894 cactacaagaaatatgacattttgccagggattttgacaggggtttggaacccctggcaaatttgccagggaaaatgccaaggacaac 31519981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 32 - 128
Target Start/End: Complemental strand, 17311518 - 17311421
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcata 128  Q
    |||||||||||  ||||| ||||||||||||||||| || || |||| ||||||||| ||||||||||||||||||||  ||||||||  ||||||||    
T  17311518 cactacaagaaatatgacattttgccagggattttgacaggggtttggaacccctgggaaatttgccagggaaaatgccaaggacaacacctggcata 17311421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 31 - 101
Target Start/End: Original strand, 20106165 - 20106236
Alignment:
Q  31 acactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccaggg 101  Q
    ||||||||||||  ||||| | ||||||||||||||| || || ||| |||||||||| |||||||||||||    
T  20106165 acactacaagaaatatgacatattgccagggattttgacaggggttttaaacccctgggaaatttgccaggg 20106236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1414 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: scaffold1414
Description:

Target: scaffold1414; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 32 - 361
Target Start/End: Original strand, 1161 - 1493
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaaggtttgaaacccctggca---aatttgccagggaaaatgcacaggacaaccgctggcata 128  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||   ||||||||||||||| |    
T  1161 cactacaagaataatggccttttgccagggattttgtcaaggtttgaaacccctggcagcaaatttgccagggaaaatgccagggacaaccgctggcaaa 1260  T
Q  129 aaagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtca 228  Q
    ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||  | ||||||||| |||||||| ||||||||| || |||||||    
T  1261 aaagacagggactttgcccctcgttttttgtaaaatgccctggcttttgtttaggcgggactttgaaaatccaaaagctgaaggaatctctgctgtgtca 1360  T
Q  229 gagaaaaccgacggcttctgccaaggatgcgcccttcggatgcgcaaatgtcagcctttttccggttgacttgacaaggtactgggaaagctggtccgtt 328  Q
    ||||||||||||||||| ||||| || |  | || ||||||||||||||  ||| |||||||||||||| |||||||||  ||||||||||  ||| |||    
T  1361 gagaaaaccgacggcttatgccagggctttgtccctcggatgcgcaaattgcaggctttttccggttgagttgacaaggcgctgggaaagcgtgtctgtt 1460  T
Q  329 gcaggcctgccaggggctaaacgcctcgcaaat 361  Q
    |||||  ||||||||| ||||| ||||| ||||    
T  1461 gcaggggtgccaggggataaacccctcggaaat 1493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 98; Significance: 4e-48; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 30 - 207
Target Start/End: Complemental strand, 33891987 - 33891810
Alignment:
Q  30 aacactacaagaataatgaccttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataa 129  Q
    |||||||||||||  ||  | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||| ||    
T  33891987 aacactacaagaaacattgcgttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcaaaa 33891888  T
Q  130 aagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagct 207  Q
    ||| ||||||||||||||||||||||||||  || | ||||||     ||||||||||||||||||| ||||||||||    
T  33891887 aagccagggactttgcccctcgttttttgtccaaagccgtggcaaacatttaggcgccagtttgaaatttcaaaagct 33891810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 30 - 207
Target Start/End: Complemental strand, 37574972 - 37574807
Alignment:
Q  30 aacactacaagaataatgaccttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataa 129  Q
    |||||||||||||  ||  | ||||||||||||||||||||||||||||||||||||||||||||||||||||            |||||||||||| ||    
T  37574972 aacactacaagaaacattgcgttttgccagggattttgtcaaggtttgaaacccctggcaaatttgccaggga------------caaccgctggcaaaa 37574885  T
Q  130 aagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagct 207  Q
    ||| |||||||||||||||||||||||||| ||| | |||||| | | |||||||||||| |||||| ||||||||||    
T  37574884 aagccagggactttgcccctcgttttttgtcaaaagccgtggcatatttttaggcgccagattgaaatttcaaaagct 37574807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 72 - 163
Target Start/End: Complemental strand, 2063654 - 2063564
Alignment:
Q  72 ggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaaagacagggactttgcccctcgttttttgtaaaa 163  Q
    |||||||| ||||||||||||||||||||||||||||  |||||||||||||||| |||| || |||  |||||||||||||| || |||||    
T  2063654 ggtttgaagcccctggcaaatttgccagggaaaatgccaaggacaaccgctggcaaaaaacactggg-gtttgcccctcgtttattttaaaa 2063564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 92; Significance: 2e-44; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 32 - 242
Target Start/End: Complemental strand, 34678745 - 34678535
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    |||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||| |  |||| ||||| ||||| |||    
T  34678745 cactacaagaataatgaccttttgccagggattttgacaagggtttgatacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa 34678646  T
Q  131 agacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcaga 230  Q
    ||||||||| ||||||||| | ||||||| |||   | |||||||  ||||||||||||||||||  || |||| |||| ||||||  || | |||||||    
T  34678645 agacaggga-tttgccccttgctttttgtcaaaatccctggctttattttaggcgccagtttgaattttgaaaatctaagggaatccctgctatgtcaga 34678547  T
Q  231 gaaaaccgacgg 242  Q
    ||||||||||||    
T  34678546 gaaaaccgacgg 34678535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 32 - 276
Target Start/End: Complemental strand, 20339024 - 20338780
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||  |||| ||| |||||||||||    
T  20339024 cactacaagaataatgaccttttgccagggattttgtcaagggtttgacacccctggaaaatttgccagggaaaatgccaaggagaactgctggcataaa 20338925  T
Q  131 agacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtca-g 229  Q
    |||||||||  |||||||||||||||   |||| | ||| |||||| || ||| ||||   ||||| ||||||||||   | ||| | || ||||||| |    
T  20338924 agacaggga-gttgcccctcgtttttgtcaaaaagccgtcgctttttttaaggtgccaagatgaaatttcaaaagct-gtgaaatttctgctgtgtcagg 20338827  T
Q  230 agaaaaccgacggcttctgccaaggatgcgcccttcggatgcgcaaa 276  Q
    | ||||||||||| || ||||| |||  ||||| |||||||||||||    
T  20338826 acaaaaccgacggattatgccagggaaacgcccctcggatgcgcaaa 20338780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 35 - 207
Target Start/End: Complemental strand, 49329602 - 49329430
Alignment:
Q  35 tacaagaataatgaccttttgccagggattttgtcaa-ggtttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaaaga 133  Q
    ||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||  |||| ||| ||||||||||||||    
T  49329602 tacaaaaataatgactttttgccagggattttgtcaatggtttgaaacccctggcaaatttgccagggaaaatgccaaggagaactgctggcataaaaga 49329503  T
Q  134 cagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagct 207  Q
    ||||||  ||||||| |||||||   |||| | ||| | |||| |||||||||||   ||||| ||||||||||    
T  49329502 caggga-gttgccccacgtttttgtcaaaaagccgtcgtttttttttaggcgccaagatgaaatttcaaaagct 49329430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 32 - 128
Target Start/End: Complemental strand, 2399664 - 2399567
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcata 128  Q
    |||||||||||  ||||| ||||||||||||||||| ||||| ||||  |||||||||||||||||||||||||||||  ||||||||  ||||||||    
T  2399664 cactacaagaaatatgacattttgccagggattttgacaagggtttggtacccctggcaaatttgccagggaaaatgccaaggacaacacctggcata 2399567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 83; Significance: 4e-39; HSPs: 1)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 32 - 276
Target Start/End: Complemental strand, 1347 - 1103
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||  |||| ||| |||||||||||    
T  1347 cactacaagaataatgaccttttgccagggattttgtcaagggtttgacacccctggaaaatttgccagggaaaatgccaaggagaactgctggcataaa 1248  T
Q  131 agacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtca-g 229  Q
    |||||||||  |||||||||||||||   |||| | ||| |||||| || ||| ||||   ||||| ||||||||||   | ||| | || ||||||| |    
T  1247 agacaggga-gttgcccctcgtttttgtcaaaaagccgtcgctttttttaaggtgccaagatgaaatttcaaaagct-gtgaaatttctgctgtgtcagg 1150  T
Q  230 agaaaaccgacggcttctgccaaggatgcgcccttcggatgcgcaaa 276  Q
    | ||||||||||| || ||||| |||  ||||| |||||||||||||    
T  1149 acaaaaccgacggattatgccagggaaacgcccctcggatgcgcaaa 1103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 83; Significance: 4e-39; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 33 - 242
Target Start/End: Complemental strand, 16924530 - 16924321
Alignment:
Q  33 actacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaaa 131  Q
    |||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||||||||||||||||||| |  |||| ||||| ||||| ||||    
T  16924530 actacaagaataatgaccttttgctagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaaa 16924431  T
Q  132 gacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctaaaggaatctttgttgtgtcagag 231  Q
    |||||||| ||||||||||| ||||||  |||   | | |||||| |||||||||||| |||||  || |||| || | ||||||| || | ||||| ||    
T  16924430 gacaggga-tttgcccctcgctttttgccaaaatccctcgcttttttttaggcgccagattgaatttttaaaatctgagggaatctctgctatgtcaaag 16924332  T
Q  232 aaaaccgacgg 242  Q
    |||||||||||    
T  16924331 aaaaccgacgg 16924321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 116 - 206
Target Start/End: Complemental strand, 38973378 - 38973288
Alignment:
Q  116 aaccgctggcataaaagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagc 206  Q
    |||| ||||||||||||||||||||||||||||||||||||||| ||  | |||||| | | ||||||||||| ||||||| |||||||||    
T  38973378 aacccctggcataaaagacagggactttgcccctcgttttttgtcaatagccgtggcatatttttaggcgccactttgaaatttcaaaagc 38973288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 92 - 242
Target Start/End: Original strand, 32215122 - 32215271
Alignment:
Q  92 tttgccagggaaaatgcacaggacaaccgctggcataaaagacagggactttgcccctcgttttttgtaaaatggcgtggcttttgtttaggcgccagtt 191  Q
    ||||||||||||||| |  |||| ||||| ||||| |||||||||||| ||||||||||| ||||||  |||   ||| | |||| || |||||||||||    
T  32215122 tttgccagggaaaataccaaggaaaaccggtggcacaaaagacaggga-tttgcccctcgctttttgccaaaatccgtcggttttattaaggcgccagtt 32215220  T
Q  192 tgaaaattcaaaagctaaaggaatctttgttgtgtcagagaaaaccgacgg 242  Q
    ||||  || |||| || | ||||||| || | |||||||||||||||||||    
T  32215221 tgaattttgaaaatctgagggaatctctgctatgtcagagaaaaccgacgg 32215271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 32 - 128
Target Start/End: Original strand, 5322641 - 5322739
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg--tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcata 128  Q
    |||||||||||  || |||||||| ||||||||||| || ||  |||||||||||||| |||||| |||||||||||||  |||| |||| ||||||||    
T  5322641 cactacaagaaacattaccttttgtcagggattttgacagggggtttgaaacccctgggaaatttaccagggaaaatgccaaggataacccctggcata 5322739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 89
Target Start/End: Complemental strand, 38973427 - 38973368
Alignment:
Q  30 aacactacaagaataatgaccttttgccagggattttgtcaaggtttgaaacccctggca 89  Q
    |||||||||||||  ||  | |||||||||||||||||||||||||||||||||||||||    
T  38973427 aacactacaagaaacattgcattttgccagggattttgtcaaggtttgaaacccctggca 38973368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 94
Target Start/End: Complemental strand, 20361082 - 20361018
Alignment:
Q  31 acactacaagaataatgaccttttgccagggattttgtcaaggt-ttgaaacccctggcaaattt 94  Q
    ||||||||||||  || ||||||||| |||||||||| || ||| ||||||||||||||||||||    
T  20361082 acactacaagaaacattaccttttgctagggattttgacagggtcttgaaacccctggcaaattt 20361018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0669 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: scaffold0669
Description:

Target: scaffold0669; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 31 - 158
Target Start/End: Complemental strand, 6909 - 6782
Alignment:
Q  31 acactacaagaataatgaccttttgccagggattttgtcaaggttt-gaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataa 129  Q
    |||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |  |||| ||||| ||||| ||    
T  6909 acactacaagaataatgaccctttgccagggattttgacaaggttttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaa 6810  T
Q  130 aagacagggactttgcccctcgttttttg 158  Q
    |||||||||| ||||||||||| ||||||    
T  6809 aagacaggga-tttgcccctcgctttttg 6782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 77; Significance: 1e-35; HSPs: 8)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 31 - 158
Target Start/End: Complemental strand, 33908960 - 33908833
Alignment:
Q  31 acactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataa 129  Q
    |||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |  |||| ||||| ||||| ||    
T  33908960 acactacaagaataatgaccctttgccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaa 33908861  T
Q  130 aagacagggactttgcccctcgttttttg 158  Q
    |||||||||| ||||||||||| ||||||    
T  33908860 aagacaggga-tttgcccctcgctttttg 33908833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 30 - 163
Target Start/End: Complemental strand, 18554463 - 18554330
Alignment:
Q  30 aacactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcata 128  Q
    ||||||||||||||| | |||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||  |||||||||||||||| |    
T  18554463 aacactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaatttgccagggaaaatgccaaggacaaccgctggcaaa 18554364  T
Q  129 aaagacagggactttgcccctcgttttttgtaaaa 163  Q
    ||| || |||  |||||||||||||| || |||||    
T  18554363 aaacactggg-gtttgcccctcgtttattttaaaa 18554330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 31 - 163
Target Start/End: Original strand, 23702319 - 23702451
Alignment:
Q  31 acactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataa 129  Q
    |||||||||||||| | |||||||||||||||||||| ||||| |||||| |||||||||||||| |||||||||||||  |||||||||||||||| ||    
T  23702319 acactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaattttccagggaaaatgccaaggacaaccgctggcaaaa 23702418  T
Q  130 aagacagggactttgcccctcgttttttgtaaaa 163  Q
    || || |||  |||||||||||||| || |||||    
T  23702419 aacactggg-gtttgcccctcgtttattttaaaa 23702451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 31 - 163
Target Start/End: Original strand, 23720775 - 23720907
Alignment:
Q  31 acactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataa 129  Q
    |||||||||||||| | |||||||||||||||||||| ||||| |||||| |||||||||||||| |||||||||||||  |||||||||||||||| ||    
T  23720775 acactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaattttccagggaaaatgccaaggacaaccgctggcaaaa 23720874  T
Q  130 aagacagggactttgcccctcgttttttgtaaaa 163  Q
    || || |||  |||||||||||||| || |||||    
T  23720875 aacactggg-gtttgcccctcgtttattttaaaa 23720907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 31 - 163
Target Start/End: Original strand, 23739231 - 23739363
Alignment:
Q  31 acactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataa 129  Q
    |||||||||||||| | |||||||||||||||||||| ||||| |||||| |||||||||||||| |||||||||||||  |||||||||||||||| ||    
T  23739231 acactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaattttccagggaaaatgccaaggacaaccgctggcaaaa 23739330  T
Q  130 aagacagggactttgcccctcgttttttgtaaaa 163  Q
    || || |||  |||||||||||||| || |||||    
T  23739331 aacactggg-gtttgcccctcgtttattttaaaa 23739363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 45 - 128
Target Start/End: Original strand, 20850223 - 20850307
Alignment:
Q  45 atgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcata 128  Q
    ||||| ||||||||||||||||| || || ||||||||||||||||||||||||| |||||||||  ||||||||  ||||||||    
T  20850223 atgacattttgccagggattttggcaggggtttgaaacccctggcaaatttgccaaggaaaatgcgaaggacaacacctggcata 20850307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 32 - 128
Target Start/End: Original strand, 6305834 - 6305931
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcata 128  Q
    |||||||||||  ||||| ||||||||||||||||| || || ||||  |||||||||||||||| ||||||||||||  ||||||||  ||||||||    
T  6305834 cactacaagaaatatgacattttgccagggattttgacaggggtttggtacccctggcaaatttgtcagggaaaatgccaaggacaacacctggcata 6305931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 77 - 106
Target Start/End: Original strand, 46830182 - 46830211
Alignment:
Q  77 gaaacccctggcaaatttgccagggaaaat 106  Q
    ||||||||||||||||||||||||||||||    
T  46830182 gaaacccctggcaaatttgccagggaaaat 46830211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0573 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0573
Description:

Target: scaffold0573; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 32 - 163
Target Start/End: Complemental strand, 6968 - 6837
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgcacaggacaaccgctggcataaa 130  Q
    ||||||||||||| | |||||||||||||||||||| ||||| |||||| ||||||||||||||| ||||||||||||  |||||||||||||||| |||    
T  6968 cactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaatttgtcagggaaaatgccaaggacaaccgctggcaaaaa 6869  T
Q  131 agacagggactttgcccctcgttttttgtaaaa 163  Q
    | || |||  |||||||||||||| || |||||    
T  6868 acactggg-gtttgcccctcgtttattttaaaa 6837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1371 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold1371
Description:

Target: scaffold1371; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 108
Target Start/End: Complemental strand, 1899 - 1822
Alignment:
Q  32 cactacaagaataatgaccttttgccagggattttgtca-aggtttgaaacccctggcaaatttgccagggaaaatgc 108  Q
    ||||||||||| |||| || ||||| |||||||||| ||  |||   ||||||||||||||||| |||||||||||||    
T  1899 cactacaagaaaaatgcccatttgctagggattttgacaggggtaaaaaacccctggcaaatttaccagggaaaatgc 1822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University