View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11470_low_41 (Length: 269)
Name: NF11470_low_41
Description: NF11470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11470_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 48 - 257
Target Start/End: Complemental strand, 39498311 - 39498099
Alignment:
| Q |
48 |
tttttattattattatcattgatgtagaaatatatgatctatgggtaaaagtagtaagcaaaaatagtcgatcaaaaatgacgaaaattcaattgtaatg |
147 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39498311 |
ttttttttattattatcatcgatgtagaaatatatgatctatgggtaaaggtagtaagcaaaaatagtcgatcaaaaatgacgaaaattcaattgtaagg |
39498212 |
T |
 |
| Q |
148 |
tcaacgcttccttccctaattcccttgatagtgt---aggcgtcggcgtttgcattagagatgatcaaggagtttttgtattggctcgaactaggtggtt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39498211 |
tcaacgcttccttccctaattcccttgatagtgtaggaggcgtcggggtttgcattagagatgatcaaggagtttttgtactggctcgaactaggtggtt |
39498112 |
T |
 |
| Q |
245 |
gtctcctatgctt |
257 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39498111 |
gtctcctatgctt |
39498099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University