View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11470_low_45 (Length: 250)

Name: NF11470_low_45
Description: NF11470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11470_low_45
NF11470_low_45
[»] chr4 (2 HSPs)
chr4 (4-142)||(44624937-44625075)
chr4 (23-97)||(44630831-44630905)


Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 4 - 142
Target Start/End: Complemental strand, 44625075 - 44624937
Alignment:
4 catttactaaattgacatcatccttaacatatttcataccacctaaccactaatactaagtgtgtgtttggaaagttggctaactcttaaattaccgcgg 103  Q
    |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
44625075 catttactaaattgacatgatccttaacatatgtcataccacctaaccactaataccaagtgtgtgtttggaaagttggctaactcttaaattaccgcgg 44624976  T
104 ttttataaaaacaaactagttatatgggtgcatttgatt 142  Q
    ||||||||||||||||||||||||||||||| |||||||    
44624975 ttttataaaaacaaactagttatatgggtgcgtttgatt 44624937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 23 - 97
Target Start/End: Complemental strand, 44630905 - 44630831
Alignment:
23 atccttaacatatttcataccacctaaccactaatactaagtgtgtgtttggaaagttggctaactcttaaatta 97  Q
    ||||||||||||| | | | |||||||| | ||||||||||||| ||||| |||||| ||| |||||||||||||    
44630905 atccttaacatatcttacatcacctaacaagtaatactaagtgtatgtttagaaagtcggccaactcttaaatta 44630831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University