View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11470_low_48 (Length: 243)
Name: NF11470_low_48
Description: NF11470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11470_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 41081052 - 41081277
Alignment:
| Q |
1 |
tttcttaaataggttcagatttattgtttggaaaattaaggtagagcaagaaaacggccaattgagatttttaaaaaatagcatttcaaattttcattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41081052 |
tttcttaaataggttcagatttattgtttggaaaattaaggtagagcaagaaaacggccaattgagatttttaaaaaatagcatttcaaatttttattag |
41081151 |
T |
 |
| Q |
101 |
ttgcatctaactatttgaggcttaaatctctgtagaaacttctaaaaggaattggccaaatattggatagctatccactagcagcagcaggtaaatgtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41081152 |
ttgcatctaactatttgaggcttaaatctctgtagaaacttctaaaaggaattggccaaatattggatagctatccactagcagcagcaggtaaatgtat |
41081251 |
T |
 |
| Q |
201 |
attttgatttgatatatacatacatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41081252 |
attttgatttgatatatacatacatt |
41081277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University