View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11470_low_56 (Length: 226)

Name: NF11470_low_56
Description: NF11470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11470_low_56
NF11470_low_56
[»] chr4 (1 HSPs)
chr4 (41-141)||(41828490-41828590)


Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 41 - 141
Target Start/End: Complemental strand, 41828590 - 41828490
Alignment:
41 tcacatgatggaaattgaatgaagtgaaggttaacagcaatccagctagtgtgctatcaattcatggttgatgtcttggtttcctagtttggtttggttt 140  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||    
41828590 tcacatgatggaaattgaatgaagtgaaggttaacagtaatccagctagtgtgctatcaattcatggttgatgtcttagtttcctagttaggtttggttt 41828491  T
141 g 141  Q
    |    
41828490 g 41828490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University