View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11471_high_10 (Length: 299)
Name: NF11471_high_10
Description: NF11471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11471_high_10 |
 |  |
|
| [»] scaffold1333 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1333 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: scaffold1333
Description:
Target: scaffold1333; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 9 - 280
Target Start/End: Original strand, 1474 - 1745
Alignment:
| Q |
9 |
agcagagaagcttaaggaaaaagagaaagaatgtgagccaaaattgtatgcttgcagcttagaacagaaagaaaaaacttgctttagaggatgttaattt |
108 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1474 |
agcagagaagcttaaggaaaaagagagagaatgtgagccaaaattctatgcttgcagcttagaacagaaagaaaaaacttgctttagaggatgttaattt |
1573 |
T |
 |
| Q |
109 |
gaggagtgagttaaacatttagtaatacttgagagaagtctatattagagaagtggaggaaatgaaattcaatgaagaaaattggcaaaagaagaatcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1574 |
gaggagtgagttaaacatttagtaatacttgagagaagtctatattagagaagtggaggaaatgaaattcaaagaagaaaattggcaaaagaagaatcaa |
1673 |
T |
 |
| Q |
209 |
gacttggggaatcaaaaagtttctcagagaaaaatcaaaccatcaaaccatacaaagagtttagctgaatct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1674 |
gacttggggaatcaaaaagtttctcagagaaaaatcaaaccatcaaaccatacaaagagtttagctgaatct |
1745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University