View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11471_high_14 (Length: 259)
Name: NF11471_high_14
Description: NF11471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11471_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 33216802 - 33216581
Alignment:
| Q |
20 |
acttcttcttctcattcaaaggatttgtttgatctttcgcaacagaaccttgttggttggaacttcttctcatatcaatggcatctgaaaaacctctttt |
119 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33216802 |
acttcttcttctcgttcaaaggatttgtttgatctttcgcaacagaaccttgttggttggaactttttctcatatcaatggcatctgaaaaacctctttt |
33216703 |
T |
 |
| Q |
120 |
tgcacctgaaaataaactattaagcatgcataaagagtatgcannnnnnncttcaagaagatcattatctctctctggtgattcagaaccaggtaaacca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33216702 |
tgcacctgaaaataaactattaagcatgcataaagagtatgcatttttttcttcaagaagatcattatctctctctggtgattcagaaccaggtaaacca |
33216603 |
T |
 |
| Q |
220 |
agtcttaactcagtagccttga |
241 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33216602 |
agtcttaactcagtagccttga |
33216581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University