View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11471_high_17 (Length: 247)
Name: NF11471_high_17
Description: NF11471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11471_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 85 - 223
Target Start/End: Complemental strand, 47907533 - 47907395
Alignment:
| Q |
85 |
tgaataaaacatgtgtacttattaatcaataaatacatatatgtttttggtgccataagggttaattttctcttcnnnnnnncttaaccaaggaaaacta |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47907533 |
tgaataaaacatgtgtacttattaatcaataaatacatatatgtttttggtgccataagggttaattttctcttctttttttcttaaccaaggaaaacta |
47907434 |
T |
 |
| Q |
185 |
attcgtttcattgcaaataatatttcatggttagtatac |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47907433 |
attcgtttcattgcaaataatatttcatggttagtatac |
47907395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 47907626 - 47907565
Alignment:
| Q |
8 |
cacagacctcaagacctcaacccttccattctagtcaatccccttcttgttgatcataaact |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47907626 |
cacagacctcaagacctcaacccttccattctagtcaatccccttcttgttgatcataaact |
47907565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University