View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11471_low_16 (Length: 289)
Name: NF11471_low_16
Description: NF11471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11471_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 20597797 - 20597615
Alignment:
| Q |
1 |
tcatacatgaaatagcatgacagcagggcaatcctattagtagccatttcctgcagtcacaagaccatctttgcaggttgacatgaaacttgtcaccact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20597797 |
tcatacatgaaatagcatgacagcagggcaatcctgttagtagccatttcctgcagtcacaagaccatctttgcaggttgacatgaaacttgtcaccact |
20597698 |
T |
|
| Q |
101 |
taaagaaacatgcctaacttcataatcaaactcatttgcacgcctacaaatataacatttcataaaattaatatcactactaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20597697 |
taaagaaacatgcctaacttcataatcaaactcatttgcacgcctacaaatataacatttcataaaattaatatcactactaa |
20597615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 193 - 275
Target Start/End: Complemental strand, 20597514 - 20597432
Alignment:
| Q |
193 |
tgttgggtaacacaccatccttcaacattgcagctttctgcctgtttgcttcccatctctccatcaagtacactctgatgtcc |
275 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20597514 |
tgttgggtaacacaccatcctccaacattgcagctttctgcctgtttgcttcccatctctccatcaggtacactctgatgtcc |
20597432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 8698798 - 8698618
Alignment:
| Q |
1 |
tcatacatgaaatagcatgacagcagggcaatcctattagtagccatttcctgcagtcacaagaccatctttgcaggttgacatgaaacttgtcaccact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
8698798 |
tcatacatgaaatagcatgacagcagggcaatcctgttagtaaccatttcctgcagtcacaagaccatctttgcaggttgacatgaaacttgtgaccagt |
8698699 |
T |
|
| Q |
101 |
taaagaaacatgcctaacttcataatcaaactcatttgcacgcctacaaatataacatttcataaaattaatatcactact |
181 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
8698698 |
taaagaaacatgtctaacttcataatcaaactcatttgcacgcctacaaatataacatttcataaaattagtatcgctact |
8698618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 193 - 272
Target Start/End: Complemental strand, 8698514 - 8698435
Alignment:
| Q |
193 |
tgttgggtaacacaccatccttcaacattgcagctttctgcctgtttgcttcccatctctccatcaagtacactctgatg |
272 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8698514 |
tgttgggtaacacaccatcctccaacattgcagctttctgcctgtttgcttcccatctctccatcaggtacactctgatg |
8698435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 227 - 268
Target Start/End: Original strand, 37101837 - 37101878
Alignment:
| Q |
227 |
tttctgcctgtttgcttcccatctctccatcaagtacactct |
268 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
37101837 |
tttctgcctatttgcttcccatctctccatcaggtacactct |
37101878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University