View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11471_low_27 (Length: 238)
Name: NF11471_low_27
Description: NF11471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11471_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 25711557 - 25711778
Alignment:
| Q |
1 |
tcttacgtaacatgcaatctatcagtaatattttttaatcaaagatacttttggtaaaaggagaattnnnnnnncaatgagaattataaatgttttagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25711557 |
tcttacgtaacatgcaatctatcagtaatattttttaatcaaagatacttttgctaaaaggagaattaaaaaaacaatgagaattataaatgttttagca |
25711656 |
T |
 |
| Q |
101 |
aaagatttgagctctcagtattgcaattaaacaagggcaggtgtcaaagtgcttcgaaattatattaagatagtacgagtattatacaataannnnnnna |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25711657 |
aaagatttgagctctcagtattgcaattaaacaagggcaggtgtcacagtgcttcgaaattatattaagatagtacgagtattatacaataattttttta |
25711756 |
T |
 |
| Q |
201 |
atttgtctcataatcttgaaac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
25711757 |
atttgtctcataatcttgaaac |
25711778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University