View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11472_high_20 (Length: 283)
Name: NF11472_high_20
Description: NF11472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11472_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 25583667 - 25583418
Alignment:
| Q |
1 |
agtgccctaaatgcaaaagcactgttttacttgatttccatcatgaaaacaacaactccaaaaggaggaattaactgcatgtttggaattacagtgagtt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583667 |
agtgccctaaatgtaaaagcactgttttacttgatttccatcatgaaaacaacaactccaaaaggaggaattaactgcatgtttggaattacagtgagtt |
25583568 |
T |
 |
| Q |
101 |
taacgaaatcacagtagcgccgtcgtttggttgaagcttcaaaatgaagtttttgccaaaattacggtaataaaaaactcacagtcaatccaaacatgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583567 |
taacgaaatcacagtagcgccgtcgtttggttgaagcttcaaaatgtagtttttgccaaaattacggtaataaaaaactcacagtcaatccaaacatgca |
25583468 |
T |
 |
| Q |
201 |
ttaagtgtaggttaccctgttgccagttctgcattctctgttggtagtag |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25583467 |
ttaagtgtaggttaccctgttgccagttctgcattctatgttggtagtag |
25583418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 76 - 112
Target Start/End: Complemental strand, 41696812 - 41696776
Alignment:
| Q |
76 |
tgcatgtttggaattacagtgagtttaacgaaatcac |
112 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41696812 |
tgcatgtttggaatgacagtgagtttaacgaaatcac |
41696776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University