View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11472_high_25 (Length: 245)
Name: NF11472_high_25
Description: NF11472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11472_high_25 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 23 - 210
Target Start/End: Original strand, 333503 - 333690
Alignment:
| Q |
23 |
gatcgatcaattcctgtgttcgagtaaacatgacggacactactgatgacattgccgaggaaatgtccttccaaggcttcgacgatgactgtaagttgct |
122 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
333503 |
gatcgatcaatttctgtgttcgagtaaacatgacggacactactgatgacattgccgaggaaatgtccttccaaggcttcgacgatgactgtaagttgct |
333602 |
T |
 |
| Q |
123 |
tggaaatcttctcaaagatgttttacaaagggaagttggcatcgactttgttgaaaaacttgcaaaaattcgaatccttgcacaggtt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
333603 |
tggaaatcttctcaaagatgttttacaaagggaagttggcatcgactttgttgaaaaacttgcaaaaattcgaatccttgcacaggtt |
333690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 52 - 137
Target Start/End: Original strand, 42168930 - 42169015
Alignment:
| Q |
52 |
atgacggacactactgatgacattgccgaggaaatgtccttccaaggcttcgacgatgactgtaagttgcttggaaatcttctcaa |
137 |
Q |
| |
|
||||| |||||||| ||||| ||||| || ||||| || ||||| |||| || ||||| |||| ||||||||| ||||||||||| |
|
|
| T |
42168930 |
atgacagacactacagatgatattgctgaagaaatctcgttccagagctttgatgatgattgtaggttgcttggtaatcttctcaa |
42169015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University