View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11472_high_27 (Length: 242)
Name: NF11472_high_27
Description: NF11472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11472_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 25583655 - 25583878
Alignment:
| Q |
1 |
catttagggcactttggatcatcttcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctgttagagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583655 |
catttagggcactttggatcatcttcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctgttagagt |
25583754 |
T |
|
| Q |
101 |
atctctgttggttgtttccatcttcttggtttagctcagtggacacacatgaacttggtggggatgtaggtgacactgttgctgatcttgttggtgatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583755 |
atctctgttggttgtttccatcttcttggtttagctcagtggacacacatgaacttggtggggatgtaggtgacactgttgctgatcttgttggtgatga |
25583854 |
T |
|
| Q |
201 |
ctcaactcttctgtggtcaaccct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
25583855 |
ctcaactcttctgtggtcaaccct |
25583878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 93
Target Start/End: Complemental strand, 42894155 - 42894075
Alignment:
| Q |
13 |
tttggatcatcttcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctg |
93 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||| ||||||||||||||||| || || | |||||| || ||||| |||||| |
|
|
| T |
42894155 |
tttggatcattctcagagagcatcacatacatgagacaacgaggacaacctactaacagcatggaggttgcttcagggctg |
42894075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University