View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11472_low_10 (Length: 369)
Name: NF11472_low_10
Description: NF11472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11472_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 9 - 358
Target Start/End: Original strand, 18644240 - 18644588
Alignment:
| Q |
9 |
aatgaaacaagacattaaaaaa-tcaagattacaagtaaggctcacaaaatacctaaaacaaaagctttgattactcattcatagtgaaacaagtactaa |
107 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
18644240 |
aatgaaacaagacattaaaaaaatcaagattacaagtaaggctcacaaaatatctaaaacaaaagcttt-attactcattcacagtgaaacaagtactaa |
18644338 |
T |
|
| Q |
108 |
tctcaattacctttgcaataatttgcctgccagactcaatcaaaatctgcaatcccaatgttgccatcactgatgcaaaaacaatgataccctgcagnnn |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
18644339 |
tctcaattacctttgcaataatttgcctgccagactcaatcaaaatctgcaatcccaaggtcgccatcactgatgcaaaaacaatgataccctgca-taa |
18644437 |
T |
|
| Q |
208 |
nnnntcttaagtcactatttgtatcatggttataaattccagttgggataacgattgcaggaattgccattacgggcattggagctgttgctatgcttat |
307 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||| ||||||||||| |||| || |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18644438 |
aacgtcttaagtcaatatttgtatcatggttttaaattccggttgggataacagttgcggggattgccattacgggcattggagctgttgctgtgcttat |
18644537 |
T |
|
| Q |
308 |
tctggtcgttgtgttgtgaatctattttttcttagcattagttaaaatcta |
358 |
Q |
| |
|
| |||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18644538 |
tgtggttgttgtgttgtgaatctattttttcttagcatcagttaaaatcta |
18644588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 113 - 203
Target Start/End: Original strand, 27308999 - 27309089
Alignment:
| Q |
113 |
attacctttgcaataatttgcctgccagactcaatcaaaatctgcaatcccaatgttgccatcactgatgcaaaaacaatgataccctgca |
203 |
Q |
| |
|
||||||||||||| |||||||| || ||||| |||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27308999 |
attacctttgcaaaaatttgccgaccggactcgatcaaaatctgcaagcccaaggttgccatcacggatgcaaaaacaatgataccctgca |
27309089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University