View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11472_low_13 (Length: 337)
Name: NF11472_low_13
Description: NF11472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11472_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 18 - 329
Target Start/End: Original strand, 6587643 - 6587954
Alignment:
| Q |
18 |
actattttatgagcaaggtgttggtccagcaatctatgagctagatgaagataagagggggaaggaaatggaatgggctctcataagattaggatgcaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587643 |
actattttatgagcaaggtgttggtccagcaatctatgaactagatgaagataagagggggagggaaatggaatgggctctcataagattaggatgcaac |
6587742 |
T |
 |
| Q |
118 |
cctagtgttccagcagtgttcattggtggcaagtttgtgggttcagccaacataatcatgacccttcatctcaatggctcactcaagaaaatgcttagag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587743 |
cctagtgttccagcagtgttcattggtggcaagtttgtgggttcagccaacataatcatgacccttcatctcaatggctcactcaagaaaatgcttagag |
6587842 |
T |
 |
| Q |
218 |
aagctggtgcactttggctttaggaaaacttgaaatatggaagctcgcattctagtgcaaatgcaaacagccaaaaattgccttttttatataatatcct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6587843 |
aagctggtgcactttggctttaggaaaacttgaaatatggaagctcgcattctagtgcaaatgcaaacagccaaaaatggccttttttatataatatcct |
6587942 |
T |
 |
| Q |
318 |
aaccaagccctc |
329 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6587943 |
aaccaagccctc |
6587954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University