View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11472_low_16 (Length: 331)

Name: NF11472_low_16
Description: NF11472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11472_low_16
NF11472_low_16
[»] chr8 (1 HSPs)
chr8 (225-319)||(26455843-26455937)


Alignment Details
Target: chr8 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 225 - 319
Target Start/End: Original strand, 26455843 - 26455937
Alignment:
225 ctgcaccaatgctgcttttcacttcatcttcttctttcccaacggttattctttcttccgttacaaaaccactaccctctaaaacccttatccta 319  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
26455843 ctgcaccaatgctgcttttcacttcatcttcttctttcccaacggttactctttcttccgttacaaaaccactaccctctaaaacccttatccta 26455937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University