View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11472_low_18 (Length: 316)
Name: NF11472_low_18
Description: NF11472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11472_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 6587810 - 6588122
Alignment:
| Q |
1 |
atctcaatggctcactcaagaaaatgcttagagaagctggtgcactttggctttaggaaaacttgaaatatggaagctcgcattctagtgcaaatgcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587810 |
atctcaatggctcactcaagaaaatgcttagagaagctggtgcactttggctttaggaaaacttgaaatatggaagctcgcattctagtgcaaatgcaaa |
6587909 |
T |
|
| Q |
101 |
cagccaaaaattgccttttttatataatatcctaaccaagccctcnnnnnnnn---gtgagaccttgcggctttaagaatatgcattgtattagaataat |
197 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587910 |
cagccaaaaatggccttttttatataatatcctaaccaagccctctttttttttttgtgagaccttgcggctttaagaatatgcattgtattagaataat |
6588009 |
T |
|
| Q |
198 |
ctttgttacctccaatataattttgagttgtacttctgaaactctgtgtacattgtttctcctttttcttttcttcacgaattgagtatttgcaactata |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6588010 |
ctttgttacctccaatataattttgagttgtacttctgaaactttgtgtgcattgtttctccttttt-ttttcttcacgaattgagtatttgcaactata |
6588108 |
T |
|
| Q |
298 |
taaattcatctctc |
311 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6588109 |
taaattcatctctc |
6588122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University