View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11472_low_19 (Length: 300)
Name: NF11472_low_19
Description: NF11472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11472_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 6 - 220
Target Start/End: Original strand, 52534386 - 52534600
Alignment:
| Q |
6 |
agagagaagaaaatatgtcgttgtgtgcacagtacaaataaacaaaaaattatcatcatcctctcaaaaataaaattataatcgttatttaatttccgtc |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52534386 |
agagaaaagaaaatatgtcgttgtgtgcacagtacaaataaacaaaaaattatcatcatcctctcaaaaataaaattataatcgttatttaatttccgtc |
52534485 |
T |
 |
| Q |
106 |
tacnnnnnnnnaagctaatcaatattttctatcacatacttttgtattaaataaaaatttagtttagttacaattttagtctactatattcactcacggt |
205 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52534486 |
tacttttttttaagctaatcaatattttctatcacatacttttgtattaaataaaaattaagtttggttacaattttagtctactatattcactcacggt |
52534585 |
T |
 |
| Q |
206 |
attgatcctctcatt |
220 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52534586 |
attgatcctctcatt |
52534600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 221 - 270
Target Start/End: Original strand, 52534718 - 52534767
Alignment:
| Q |
221 |
acaaacaatcgacagttgtcgagatgaatttttaggttaggaagtggggt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52534718 |
acaaacaatcgacagttgtcgagatgaatttttaggttgggaagtggggt |
52534767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University