View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11472_low_35 (Length: 238)
Name: NF11472_low_35
Description: NF11472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11472_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 2 - 225
Target Start/End: Original strand, 49950125 - 49950347
Alignment:
| Q |
2 |
cccaagcctataatctcatacaaaatctctcatcccttagccttgattccataaaatatatctctttcggtgatctatcatcggaacaaaatatacctat |
101 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49950125 |
cccaagcctataagctcatacaaaatctctcatcccttagccttgattccataaaatatatctctttcggtgatctatcatcggaacaaaatatacctat |
49950224 |
T |
 |
| Q |
102 |
caaataatccaaaaagctccatttaacggaagcataagccttttcaaagcagattgattagtcgagactaagacaaatgataacatttgcgaactactca |
201 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49950225 |
caaataatcc-aaaatttccatttaacggaagcataagccttttcaaagtagattggttagtcgagactaagacaaatgataacatttgcgaaccactca |
49950323 |
T |
 |
| Q |
202 |
gctagaattttggcaagcaatttg |
225 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
49950324 |
gctagaattctggcaagcaatttg |
49950347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University