View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11473_high_18 (Length: 343)

Name: NF11473_high_18
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11473_high_18
NF11473_high_18
[»] chr3 (1 HSPs)
chr3 (215-314)||(35341640-35341739)
[»] chr4 (2 HSPs)
chr4 (215-314)||(44184945-44185044)
chr4 (215-314)||(10420775-10420874)


Alignment Details
Target: chr3 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 215 - 314
Target Start/End: Complemental strand, 35341739 - 35341640
Alignment:
Q  215 cgggatacaaatttcgagagacttgtccagtgctccactactgtttttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt 314  Q
    |||| ||||||||||| ||||||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||    
T  35341739 cgggttacaaatttcgggagacttgtccagtgctccgctactgtttttgttctgttccattgttatcttttggatcaaacaccgcacaacttttattgtt 35341640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 215 - 314
Target Start/End: Original strand, 44184945 - 44185044
Alignment:
Q  215 cgggatacaaatttcgagagacttgtccagtgctccactactgtttttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt 314  Q
    |||| ||||||||||   |||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||    
T  44184945 cgggttacaaatttcagtagacttgtccagtgctccgctattgtttttgttctattccattgttatcttttggatcaaacaccgcacaacttttattgtt 44185044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 215 - 314
Target Start/End: Original strand, 10420775 - 10420874
Alignment:
Q  215 cgggatacaaatttcgagagacttgtccagtgctccactactgtttttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt 314  Q
    |||| ||||||||||| ||||||||||| |||||||  ||||||||||||| | |||||||||||||||||||||||||||| |||||| ||||| ||||    
T  10420775 cgggttacaaatttcgggagacttgtccggtgctccggtactgtttttgttctgttccattgttatcttttggatcaaacactgcacaatttttattgtt 10420874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University