View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_high_38 (Length: 250)
Name: NF11473_high_38
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_high_38 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 165 - 250
Target Start/End: Complemental strand, 46304551 - 46304466
Alignment:
| Q |
165 |
gaagggttgctgatattcactctcctatctctcccgatcacgtttctggttagtctctttctttctggattagggctttctttttt |
250 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46304551 |
gaagggttgctgatattcactcacctatctctcccgatcacgtttctggttagtctctttctttctggattagggctttctttttt |
46304466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 79 - 159
Target Start/End: Complemental strand, 46304785 - 46304708
Alignment:
| Q |
79 |
atatgttgaaattagggttctagagaatagagacaaattaattagtaattggatctttagacaaaaagtgatgaatattgg |
159 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46304785 |
atatgttgaaattagggttgtagagaatagagataaatt---tagtaattggatctatagacaaaaagtgatgaatattgg |
46304708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University