View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_high_51 (Length: 235)
Name: NF11473_high_51
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_high_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 114 - 219
Target Start/End: Complemental strand, 1591282 - 1591177
Alignment:
| Q |
114 |
tttgctatgactaaggagaagatcaaagaatacatggaaatagcgaaaacagcgccattcaacccttaccataattttacttggcaatgcgtcatagcta |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1591282 |
tttgctatgactaaggagaagattaaagaatacatggaaatagcgaaaacagcgccattcaacccttaccataattttacttggcaatgcgtcatagcta |
1591183 |
T |
|
| Q |
214 |
cacttg |
219 |
Q |
| |
|
|||||| |
|
|
| T |
1591182 |
cacttg |
1591177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 114 - 219
Target Start/End: Complemental strand, 19271077 - 19270972
Alignment:
| Q |
114 |
tttgctatgactaaggagaagatcaaagaatacatggaaatagcgaaaacagcgccattcaacccttaccataattttacttggcaatgcgtcatagcta |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
19271077 |
tttgctatgactaaggagaagatcaacgaatacatggaaatagcgaaaacagcgccattcaaccctcaccataattttgcttggcaatgcgtcatagcta |
19270978 |
T |
|
| Q |
214 |
cacttg |
219 |
Q |
| |
|
|||||| |
|
|
| T |
19270977 |
cacttg |
19270972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 116 - 213
Target Start/End: Complemental strand, 39616530 - 39616433
Alignment:
| Q |
116 |
tgctatgactaaggagaagatcaaagaatacatggaaatagcgaaaacagcgccattcaacccttaccataattttacttggcaatgcgtcatagcta |
213 |
Q |
| |
|
|||||| |||| |||||||||||||| ||||||||||| ||| ||||| |||||| |||||| || |||||| ||| ||||||||||||| ||||||| |
|
|
| T |
39616530 |
tgctatcactagggagaagatcaaaggatacatggaaaaagcaaaaacggcgccactcaacctttcccataactttgcttggcaatgcgtgatagcta |
39616433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University