View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_18 (Length: 354)
Name: NF11473_low_18
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 350
Target Start/End: Original strand, 11502355 - 11502705
Alignment:
| Q |
1 |
agatctaattgacccattttttctggtttgtaatgtggacaatatgattgattactatatgtttatattgaattattgattgattcaattcaaaatgctt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11502355 |
agatctaatagacccattttttctggtttgtaatgtggacaatatgattgattactatatgtttatattgaattattgattgattcaattcaaaatgctt |
11502454 |
T |
 |
| Q |
101 |
gtttcaattttaatattagagatttattcaaaaaagtannnnnnn-aatattatagattggttgttagttgcttgcttctcagcatgctcgtttggttgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11502455 |
gtttcaattttaatattagagatttattcaaaaaaatattttttttaatattatagattggttgttagttgcttgcttctcagcatgctcgtttggttgt |
11502554 |
T |
 |
| Q |
200 |
tagttgactttggacatgatcattttcaatactacatagataaaggttttattccttcatttaacattttcataatcagcaacaagaatcgattgatctt |
299 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11502555 |
tagttgactttggacatggtcattttcaatactacatagataaaggttttattccttcatttaacattttcataatcagcaacaagaatcgattgatctt |
11502654 |
T |
 |
| Q |
300 |
agtcgtaaaagatttgagctctttgggtacaggggtttcatctctgcttct |
350 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
11502655 |
agtcgtaaaagatttgagctctttgagtacaggggtttcatctctggttct |
11502705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University