View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_19 (Length: 343)
Name: NF11473_low_19
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 215 - 314
Target Start/End: Complemental strand, 35341739 - 35341640
Alignment:
| Q |
215 |
cgggatacaaatttcgagagacttgtccagtgctccactactgtttttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt |
314 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35341739 |
cgggttacaaatttcgggagacttgtccagtgctccgctactgtttttgttctgttccattgttatcttttggatcaaacaccgcacaacttttattgtt |
35341640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 215 - 314
Target Start/End: Original strand, 44184945 - 44185044
Alignment:
| Q |
215 |
cgggatacaaatttcgagagacttgtccagtgctccactactgtttttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt |
314 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44184945 |
cgggttacaaatttcagtagacttgtccagtgctccgctattgtttttgttctattccattgttatcttttggatcaaacaccgcacaacttttattgtt |
44185044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 215 - 314
Target Start/End: Original strand, 10420775 - 10420874
Alignment:
| Q |
215 |
cgggatacaaatttcgagagacttgtccagtgctccactactgtttttgttatattccattgttatcttttggatcaaacaccgcacaacttttactgtt |
314 |
Q |
| |
|
|||| ||||||||||| ||||||||||| ||||||| ||||||||||||| | |||||||||||||||||||||||||||| |||||| ||||| |||| |
|
|
| T |
10420775 |
cgggttacaaatttcgggagacttgtccggtgctccggtactgtttttgttctgttccattgttatcttttggatcaaacactgcacaatttttattgtt |
10420874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University