View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_21 (Length: 339)
Name: NF11473_low_21
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 3 - 326
Target Start/End: Complemental strand, 38339676 - 38339348
Alignment:
| Q |
3 |
tggagaagcagagacaaacttctaataaggcagaacaagataccgctagagatgcctccagatttcatgccaggggaggtggttgaagacccgacacatg |
102 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38339676 |
tggagaaacagaaacaaacttctaataaggcagaacaagataccgctagagatgcctccaaatttcatgccaggggaggtggttgaagacccgacacatg |
38339577 |
T |
|
| Q |
103 |
gaacaaatgtatgcactttttgctagtttggttttannnnnnnnatgccactattcttttgatgcacatggtttatgataattttattataaatgtaata |
202 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38339576 |
gaactaatgtatgcactttttgctagtttggttttattttttttatgccactatttttttgatgcacatggtttatgataattttattataaatgtaata |
38339477 |
T |
|
| Q |
203 |
tttatcaaaga-----tcttattgcttgctatattgtcaatggcggaacttagcgatacaatcacggcaaagtagtgcggaattgagttgtgaccatccc |
297 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38339476 |
tttatcaaagaaataatcttattgcttgctatattgtcaatggcggaacttagcgatacaatcacggcaaagtagtgcggaattgagttgtgaccatccc |
38339377 |
T |
|
| Q |
298 |
gacactgatgtagcgccatgcacattttg |
326 |
Q |
| |
|
||| ||||||||||||||||||| ||||| |
|
|
| T |
38339376 |
gacgctgatgtagcgccatgcacgttttg |
38339348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 151 - 187
Target Start/End: Complemental strand, 38331654 - 38331618
Alignment:
| Q |
151 |
cactattcttttgatgcacatggtttatgataatttt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38331654 |
cactattcttttgatgcacatggtttatggtaatttt |
38331618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University