View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_23 (Length: 329)
Name: NF11473_low_23
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 86 - 247
Target Start/End: Original strand, 4329186 - 4329347
Alignment:
| Q |
86 |
atgttcttattatctgtcaaaaccactatgtaatcaccaacatagtttaattttaatgaaatactcaattatttaattttaatatgatctagtgagttta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329186 |
atgttcttattatctgtcaaaaccactatgtaatcaccaacatagtttaattttaatgaaatactcaattatttaattttaatatgatctagtgagttta |
4329285 |
T |
|
| Q |
186 |
ttggatctttctggtggcagattccaataatagcccacattggttctagcttaatggactta |
247 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329286 |
ttggatctttctggtgacagattccaataatagcccacattggttctagcttaatggactta |
4329347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 16 - 67
Target Start/End: Original strand, 4329137 - 4329188
Alignment:
| Q |
16 |
ttaagttctgcagggaatacccttagccatcgcgatgaatagaataaaaatg |
67 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329137 |
ttaagttctgtagggaatacccttagccatcgcgatgaatagaataaaaatg |
4329188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University