View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_24 (Length: 322)
Name: NF11473_low_24
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 101 - 292
Target Start/End: Complemental strand, 40630822 - 40630631
Alignment:
| Q |
101 |
acaggtaaagggtataaaagtggatgattctaaagggctccactctgttacaggtttgtgtttctgatttgttgtttcttttgtaattcttaaattcctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40630822 |
acaggtaaagggtataaaagtggatgattctaaagggctccactctgttacaggtttgtgtttctgatttgttgtttcttttgtaattcttaaatttctc |
40630723 |
T |
|
| Q |
201 |
actttttacggtgcacggttggattcacggtgagtttggcactatcatcgtgatttcggcaaaccaccgtgatatcaaacatgcacttatga |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
40630722 |
actttttacggtgcacggttggattcacggtgagtttggcactatcatcgtgatttcggcagaccatcgtgatatcaaacatgcacttatga |
40630631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 40630922 - 40630864
Alignment:
| Q |
1 |
tcgcatcgcactctttgttagtctttgcttttttaacggttttagatttacattattaa |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
40630922 |
tcgcatcgcactctttgttagtcttttcttttttaacggttttagattaacattattaa |
40630864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University