View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_31 (Length: 283)
Name: NF11473_low_31
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 20 - 273
Target Start/End: Complemental strand, 330029 - 329776
Alignment:
| Q |
20 |
catgtcatgatagacagataaatagatcatatgcatgaagaagatattgtatgtttgctgcttcgaattgtatgtatatttttcactactcgtactaact |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
330029 |
catgtcatgatagacagataaatagatcatatgcatgaagaagatattgtatgtttgctgcttcgaattgtatatatatttttcaccactcgtactaact |
329930 |
T |
|
| Q |
120 |
tgtttgcgtttgtatattggtgcagttgtgctgctctctgctgttgctgcctattagatgcctgcttctaagaagactttactctgcactaataggattg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329929 |
tgtttgcgtttgtatattggtgcagttgtgctgctctctgctgttgctgcctattagatgcctgcttctaagaagactttactctgcactaataggattg |
329830 |
T |
|
| Q |
220 |
aagtgtgtttaagcattgagctcaatgaaaattgtttcatgtttcttttctgtg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329829 |
aagtgtgtttaagcattgagctcaatgaaaattgtttcatgtttcttttctgtg |
329776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 128 - 208
Target Start/End: Original strand, 48030582 - 48030662
Alignment:
| Q |
128 |
tttgtatattggtgcagttgtgctgctctctgctgttgctgcctattagatgcctgcttctaagaagactttactctgcac |
208 |
Q |
| |
|
|||||| |||| ||||| | |||||||||||||||||||| || || ||||| ||||| | ||||||| ||||| ||||| |
|
|
| T |
48030582 |
tttgtaaattgttgcagcttggctgctctctgctgttgctgtctcttggatgcatgcttttgagaagacattactttgcac |
48030662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University