View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_35 (Length: 254)
Name: NF11473_low_35
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 2 - 243
Target Start/End: Complemental strand, 48250172 - 48249922
Alignment:
| Q |
2 |
ccgaaaccggcgaaggaaagcggtggtggttcgtcgaagaggaaaccatttaggactttgtttcataaagag---------ggaaatggtggtgggtctg |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48250172 |
ccgaaaccggcgaaggaaagcggtggtggttcgtcgaagaggaaaccatttaggactttgtttcataaagagcataaagagggaaatggtggtgggtctg |
48250073 |
T |
|
| Q |
93 |
aggtagaacaaagaggagggaaatcagtgaaaaaacaatgggggtttgatggattgaagaaatggaagagaaatgaattggatgatgatgagactgctcc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48250072 |
aggtagaacaaagaggagggaaatcagtgaaaaaacaatgggggtttgatggattgaagaaatggaagagaaatgaattggatgatgatgagactgctcc |
48249973 |
T |
|
| Q |
193 |
tttgcctctgaatcagagatctgatagtgaggctttctcagcttcatctca |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48249972 |
tttgcctctgaatcagagatctgatagtgaggctttctcagcttcatctca |
48249922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University