View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_36 (Length: 254)
Name: NF11473_low_36
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_36 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 43186999 - 43186763
Alignment:
| Q |
18 |
gaagctgctaattacctcaagtttcttagagcacaagtcaaagaactggagaatataggaaacaagattgatacagtgaataattgtcctcctacaaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186999 |
gaagctgctaattacctcaagtttcttagagcacaagtcaaagaactggagaatataggaaacaagattgatacagtgaataattgtcctcctacaaaca |
43186900 |
T |
 |
| Q |
118 |
tagccttctccttcaacccatcaatttccatgcaaaaccctaatgtcaacatccaatattcccatgattgaaatcattattatcagaaatactagaaaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186899 |
tagccttctccttcaacccatcaatttccatgcaaaaccctaatgtcaacatccaatattcccatgattgaaatcattattatcagaaatactagaaaaa |
43186800 |
T |
 |
| Q |
218 |
gttgaaatagcgacggaaattcagagacagaaaaatg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186799 |
gttgaaatagcgacggaaattcagagacagaaaaatg |
43186763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 252
Target Start/End: Complemental strand, 32295655 - 32295615
Alignment:
| Q |
212 |
gaaaaagttgaaatagcgacggaaattcagagacagaaaaa |
252 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
32295655 |
gaaaaagttgaaataacgaaggaaattcagagacaaaaaaa |
32295615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University