View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11473_low_37 (Length: 253)

Name: NF11473_low_37
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11473_low_37
NF11473_low_37
[»] chr2 (1 HSPs)
chr2 (19-239)||(26302962-26303182)


Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 26303182 - 26302962
Alignment:
19 gcaggcaatgtgggaagtcattcaagcctgagaaaatgcataaacacatgaagtcttgtaaaggaatgaaaggcatgggaacttcagctgcagctattgc 118  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| || | |||||    
26303182 gcaggcaatgtgggaagtcattcaagcctgagaaaatgcacaaacacatgaagtcttgtaaaggaatgaaaggaatgggaacttcagctacaacaattgc 26303083  T
119 tgaggaaacacaatttcatagatcaacttcatcatctaaagattaccttttgcaaaattaaatgtggatgagtcctttgacttgacaccagaagaaacat 218  Q
    ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26303082 tgaggaaacacagcttcatagatcaacttcatcatctaaagattaccttttgcaaaattaaatgtggatgagtcctttgacttgacaccagaagaaacat 26302983  T
219 atggtttttaacttttgatgt 239  Q
    |||||||||||||||||||||    
26302982 atggtttttaacttttgatgt 26302962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University