View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_37 (Length: 253)
Name: NF11473_low_37
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 26303182 - 26302962
Alignment:
| Q |
19 |
gcaggcaatgtgggaagtcattcaagcctgagaaaatgcataaacacatgaagtcttgtaaaggaatgaaaggcatgggaacttcagctgcagctattgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| || | ||||| |
|
|
| T |
26303182 |
gcaggcaatgtgggaagtcattcaagcctgagaaaatgcacaaacacatgaagtcttgtaaaggaatgaaaggaatgggaacttcagctacaacaattgc |
26303083 |
T |
|
| Q |
119 |
tgaggaaacacaatttcatagatcaacttcatcatctaaagattaccttttgcaaaattaaatgtggatgagtcctttgacttgacaccagaagaaacat |
218 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26303082 |
tgaggaaacacagcttcatagatcaacttcatcatctaaagattaccttttgcaaaattaaatgtggatgagtcctttgacttgacaccagaagaaacat |
26302983 |
T |
|
| Q |
219 |
atggtttttaacttttgatgt |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26302982 |
atggtttttaacttttgatgt |
26302962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University