View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11473_low_39 (Length: 250)

Name: NF11473_low_39
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11473_low_39
NF11473_low_39
[»] chr4 (2 HSPs)
chr4 (165-250)||(46304466-46304551)
chr4 (79-159)||(46304708-46304785)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 165 - 250
Target Start/End: Complemental strand, 46304551 - 46304466
Alignment:
165 gaagggttgctgatattcactctcctatctctcccgatcacgtttctggttagtctctttctttctggattagggctttctttttt 250  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46304551 gaagggttgctgatattcactcacctatctctcccgatcacgtttctggttagtctctttctttctggattagggctttctttttt 46304466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 79 - 159
Target Start/End: Complemental strand, 46304785 - 46304708
Alignment:
79 atatgttgaaattagggttctagagaatagagacaaattaattagtaattggatctttagacaaaaagtgatgaatattgg 159  Q
    ||||||||||||||||||| ||||||||||||| |||||   |||||||||||||| ||||||||||||||||||||||||    
46304785 atatgttgaaattagggttgtagagaatagagataaatt---tagtaattggatctatagacaaaaagtgatgaatattgg 46304708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University