View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_40 (Length: 250)
Name: NF11473_low_40
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 21 - 245
Target Start/End: Original strand, 39091652 - 39091876
Alignment:
| Q |
21 |
gtttccactgattgtgtggggtttggtcatatccaaagacagaacatattatattgattcatcaatgacaatcaaataatgtactgtgtacnnnnnnnng |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39091652 |
gtttccactgattgtgtggggtttggtcatatccaaagacagaacatattatattgattcatcaatgacaatcaaataatgtactgtgtacttttttttg |
39091751 |
T |
|
| Q |
121 |
tctatgttacgattaatgtaggacattagtttatatttcttctgttaatgtaattgtaagattgataatggtaataaacatatgggattcacatcatgtt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39091752 |
tctatgttacgattaatgtaggacattagtttatatttcttctgttaatgtaattgtaagattgataatggtaataaacatatgggattcacatcatgtt |
39091851 |
T |
|
| Q |
221 |
catgtgacacaacttctctgcttct |
245 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39091852 |
catgtgacacaacttctctgcttct |
39091876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University