View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_43 (Length: 248)
Name: NF11473_low_43
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 84 - 243
Target Start/End: Original strand, 39902698 - 39902857
Alignment:
| Q |
84 |
ttcataaactatctcaaagaaactataaaaataagctgagatgagcttatgaacatctaataagctatcttcataagttaaaataagccaatcttaaatc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39902698 |
ttcataaactatctcaaagaaactataaaaataagctgagatgagcttatgaacatgtaataagctatcttcataagttaaaataagccaatcttaaatc |
39902797 |
T |
 |
| Q |
184 |
agttgattagattaacggaaacagcaaaggagagagtaagtacctttgtcctatgcttct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39902798 |
agttgattagattaacggaaacagcaaaggagagagtaagtacctttgtcctctgcttct |
39902857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University