View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11473_low_45 (Length: 246)

Name: NF11473_low_45
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11473_low_45
NF11473_low_45
[»] chr4 (1 HSPs)
chr4 (67-144)||(44970532-44970609)


Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 67 - 144
Target Start/End: Original strand, 44970532 - 44970609
Alignment:
67 actgattggtatagtttgggttcatgatactctgctcaaattcagggatgtttatttagggtaagtttgttttaactt 144  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
44970532 actgattggtgtagtttgggttcatgatactctgcacaaattcagggatgtttatttagggtaagtttgttttaactt 44970609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University