View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_48 (Length: 240)
Name: NF11473_low_48
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 11502095 - 11501872
Alignment:
| Q |
1 |
acttttctttgttgggtttcttcaagtttcatcgcaaattcactcggattcgaacttgcttggaaggtactgaattagttcataacgttgtatgtttcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11502095 |
acttttctttgttgggtttcttcaagtttcatcgcaaattcactcggattcgaacttgcttggaaggtactgaattagttcataacgttgtatgtttcat |
11501996 |
T |
|
| Q |
101 |
tttatttgttagcaatgatatatttcagactctaatagtttagtctaatggtaaaaaacattgaacttagattcggatatctcaagttcacgtgtgttca |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11501995 |
tttatttgttagcaataatatatttcagactctaatagtttagtctaatggtaaaaaacattgaacttagattcggatatctcaagttcacgtgtgttca |
11501896 |
T |
|
| Q |
201 |
aataatacaactctaagttaatgt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11501895 |
aataatacaactctaagttaatgt |
11501872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 71
Target Start/End: Complemental strand, 11507614 - 11507548
Alignment:
| Q |
5 |
ttctttgttgggtttcttcaagtttcatcgcaaattcactcggattcgaacttgcttggaaggtact |
71 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
11507614 |
ttctttgttgggtttcgtctagtttcatcgctaattcactcggcttccaactcgcttggaaggtact |
11507548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University