View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_51 (Length: 238)
Name: NF11473_low_51
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_51 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 25803305 - 25803528
Alignment:
| Q |
16 |
gacaatacac-gttgcttagggttcttaactataatgttttcaggggtactcttaatcacaatgagtcaaagaatatagtcaacaaaaatctagtcaaca |
114 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25803305 |
gacaatacaccgttgcttagggttcttaactataatgttttcaggggtactcttactcacaatgagtcaaagaatctagtcaacaaaaatctagtcaaca |
25803404 |
T |
|
| Q |
115 |
ttaatactcctggttttttggactagtaattactacttatagaaaaaatttgtcattttatttaattcattcaatttttacaaatgaggagacgccaatc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25803405 |
ttaatactcctggttttttggactagtaattactacttatagcaaaaatttgtcattttatttaattcattcaatttttacaaatgaggagacgccaatc |
25803504 |
T |
|
| Q |
215 |
gttttcattttccatgctacttct |
238 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
25803505 |
gttttcattttccatgctccttct |
25803528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University