View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11473_low_56 (Length: 227)
Name: NF11473_low_56
Description: NF11473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11473_low_56 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 81 - 227
Target Start/End: Original strand, 24309357 - 24309505
Alignment:
| Q |
81 |
ggtacccttcataagagacatagtagttcaattccttctattta--aatgctttggttggtgctatttaacattctcaaaaacaaaacctaacatacaat |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||| |||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24309357 |
ggtacccttcataagagacatagtagttcaattccttctatatataaattctttggttctatttatttaccattctcaaaaacaaaacctaacatacaat |
24309456 |
T |
 |
| Q |
179 |
ttttgttttcttcttaggatggagccacctcatcacattttcttagcaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24309457 |
ttttgttttcttcttaggatggagccacctcatcacattttcttagcaa |
24309505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 24309277 - 24309307
Alignment:
| Q |
1 |
gtattttcaggtgttcagaacacttctatag |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24309277 |
gtattttcaggtgttcagaacacttctatag |
24309307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University