View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11474_high_16 (Length: 333)
Name: NF11474_high_16
Description: NF11474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11474_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 20 - 329
Target Start/End: Original strand, 26355625 - 26355931
Alignment:
| Q |
20 |
catggctatgacactgttctgcaaaaagcttgaatctttactaagaaactgtgaaacaaaatggtttgaagctagtattttgtaagaaaaatggttgctt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26355625 |
catggctatgacactgttctgcaaaaagcttgaatctttactaagaaactgtgaaacaaaatggtttgaag---gtattttgtaagaaaaatggttgctt |
26355721 |
T |
 |
| Q |
120 |
agtgaaatggcaccttgtttggcacaaagaatgtagtacaacaacaccagagcatccttgcatatgaagggagaatggtaagtcaaacacccaaattacc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26355722 |
agtgaaatggcaccttgtttggcacaaagaatgtagtacagcaacaccagagcatccttgcatatgaagggagaatggtaagtcaaacacccaaattacc |
26355821 |
T |
 |
| Q |
220 |
ctttttcttgttgtaatgcgaaaatcccaaaccaaataagtggtcattttaaattatgttgaagggcattgttgtattttgcagcttggtatttctctcc |
319 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
26355822 |
ctttttttggttgtaatgcgaaaatcccaaaccaaataagtggtcattttaaattatgttgaagggcattgttgtatttggcagcttggtatttctgtcc |
26355921 |
T |
 |
| Q |
320 |
tttgcttctc |
329 |
Q |
| |
|
||| |||||| |
|
|
| T |
26355922 |
tttacttctc |
26355931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University