View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11474_high_18 (Length: 316)
Name: NF11474_high_18
Description: NF11474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11474_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 258
Target Start/End: Original strand, 29615291 - 29615535
Alignment:
| Q |
14 |
aggatgtaggcacaacaaatcaaaaactaaagataacaatcaaagcaatatcaggacgggctttgttaattatttttaattgttgtatcttgaatttctg |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29615291 |
aggatgtaggcaaaacaaatcaaaaactaaagataacaatcaaagcaatatcaggacgggctttgttaattatttttaattgttgtatcttgaatttctg |
29615390 |
T |
 |
| Q |
114 |
attacttcagatttttcattgtttaggtttacacattagctttttcaccttattggcgggatacattgtttctggacattttatatgatgacttcaggca |
213 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29615391 |
attacttcagattttccattgtttaggtttacacattagctttttcaccttattggcgggatacattgtttctggacattttatatgatgacttcaggca |
29615490 |
T |
 |
| Q |
214 |
ctactattttcgatgctgttaaggaagccatggaacatgagaccc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29615491 |
ctactattttcgatgctgttaaggaagccatggaacatgagaccc |
29615535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University