View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11474_high_20 (Length: 298)
Name: NF11474_high_20
Description: NF11474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11474_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 33163573 - 33163843
Alignment:
| Q |
1 |
gtggttattttgcaggtactttctgaaggctggatatgctgttatctttttgcaccgtaggtaaatttcttatcatgtaatttatccttttctcacgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33163573 |
gtggttattttgcaggtactttctgaaggctggatatgctgttatctttttgcaccgtaggtaaatttcttatcatgtaatttatccttttctcatgttt |
33163672 |
T |
 |
| Q |
101 |
gatgtgttgatttaccaatgaataattatgcagggggagttaccagccattttgcagatccattcctgatgatcccttacttgaatgcttcgagccaacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33163673 |
gatgtgttgatttaccaatgaataattatgcagggggagttaccagccattttgcagatccattcctgatgatcccttacttgaatgcttcgagctgacc |
33163772 |
T |
 |
| Q |
201 |
aacgatttaaatattcaaggttttccatttctgttttctcctcgcctcatgccataataagataaatagac |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33163773 |
aacgatttaaatattcaaggttttccatttctgttttctcctcgcctcatgccataataagataaatagac |
33163843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 99 - 242
Target Start/End: Complemental strand, 46162427 - 46162285
Alignment:
| Q |
99 |
ttgatgtgttgatttaccaatgaataattatgcagggggagttaccagccattttgcagatccattcctgatgatcccttacttgaatgcttcgagccaa |
198 |
Q |
| |
|
|||||||||| ||| ||||||||||| ||||||||||| |||| ||||||||||||||||||| |||| || |||||||||||||||||||||||||| | |
|
|
| T |
46162427 |
ttgatgtgttaatt-accaatgaatatttatgcaggggaagtttccagccattttgcagatcccttcccgaggatcccttacttgaatgcttcgagccca |
46162329 |
T |
 |
| Q |
199 |
ccaacgatttaaatattcaaggttttccatttctgttttctcct |
242 |
Q |
| |
|
||||||| ||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
46162328 |
ccaacgacttaaacattcaaggttttcagtttctgcattctcct |
46162285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 46162557 - 46162488
Alignment:
| Q |
1 |
gtggttattttgcaggtactttctgaaggctggatatgctgttatctttttgcaccgtaggtaaatttct |
70 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
46162557 |
gtggttactttgcaggtactttctgaaggctggatatgctgttatctttctgtaccggaggtaaatttct |
46162488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University