View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11474_high_25 (Length: 258)

Name: NF11474_high_25
Description: NF11474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11474_high_25
NF11474_high_25
[»] chr8 (1 HSPs)
chr8 (53-108)||(33812547-33812602)


Alignment Details
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 53 - 108
Target Start/End: Complemental strand, 33812602 - 33812547
Alignment:
53 aaggaagagatattagaattttgaatctttctcaattgtatccttgcaaacaaagt 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33812602 aaggaagagatattagaattttgaatctttctcaattgtatccttgcaaacaaagt 33812547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University