View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11474_low_31 (Length: 240)
Name: NF11474_low_31
Description: NF11474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11474_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33125351 - 33125573
Alignment:
| Q |
1 |
caataatattgaagattttttactacatcttccaaatgttaattaagaactaagcctctcttatttgtgctaattaatatcaaattttgagacgcatatg |
100 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33125351 |
caattatattgacgattttttactacatcttccaaatgttaattaagaactaagcctctcttatttgtgctaattaatatcaaattttgagaagcatatg |
33125450 |
T |
 |
| Q |
101 |
caatatcaaatagtcatctacatgtaataactgaaagtttgtaggcacttacaatccggagtagaacctgattccaacatttgggctgcttcctcaaagg |
200 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33125451 |
caatgtcaaatagtcatctacatataataactgaaagtttgtaggcacttacaatcaggagtagaacctgattccaacatttgggctgcttcctcaaagg |
33125550 |
T |
 |
| Q |
201 |
cttcctgaaagttcagtagcata |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33125551 |
cttcctgaaagttcagtagcata |
33125573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University