View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11475_high_51 (Length: 225)
Name: NF11475_high_51
Description: NF11475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11475_high_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 39620340 - 39620172
Alignment:
| Q |
1 |
tctctgataaaagtgtcttctgtagatcttctaggccattgattttgttcgatttgtctctaacattggcaagaaaacttgcagcttcataatggtgcac |
100 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||| | |||||||| |
|
|
| T |
39620340 |
tctctgataaaagtgtcttttgaagatcttctaggccattgattttgtttgatttctctctaacgttggcaagaaaacttgcagcttcaaattggtgcac |
39620241 |
T |
|
| Q |
101 |
gatcttgttatacaatgatgtggcaagttctgtcttccctattcctccaagtccatatatgcccaacat |
169 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||| ||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
39620240 |
aattttgttatacaatgatttggcaagttctgttttccctattccaccaagtccatgtatacccaacat |
39620172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 39581619 - 39581798
Alignment:
| Q |
1 |
tctctgataaaagtgtcttctgtagatcttctaggccattgattttgttcgatttgtctctaacattggcaagaaaacttgcagcttcataatggtgcac |
100 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||| |||| ||||||||||| ||||| |||||||||||||||| |||||||||||||||| | |||||||| |
|
|
| T |
39581619 |
tctctggtaaaagtgtctggtgtaaatcttctgggccgttgattttgtttgatttctctctaacattggcaataaaacttgcagcttcaaattggtgcac |
39581718 |
T |
|
| Q |
101 |
gatcttgttatacaatgatgtggcaagttctgtcttccctattcctccaagtccatatatgcccaacatgcatacagtgt |
180 |
Q |
| |
|
|| ||||||||||||| | ||||||||||||| || |||||||| || ||||| |||| |||||||| |||| ||||| |
|
|
| T |
39581719 |
aattttgttatacaatgctttggcaagttctgtttttcctattccaccgagtccgcatatacccaacatacatatagtgt |
39581798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 172 - 205
Target Start/End: Complemental strand, 39628202 - 39628169
Alignment:
| Q |
172 |
atacagtgtgggagcaagttgtttcaaattgtct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39628202 |
atacagtgtgggagcaagttgtttcaaattgtct |
39628169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University