View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11475_low_28 (Length: 275)
Name: NF11475_low_28
Description: NF11475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11475_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 137 - 266
Target Start/End: Complemental strand, 1028403 - 1028274
Alignment:
| Q |
137 |
caaaagtcaactaattttcttttgtatttacgagccagcactgatgaagtaatcgttgaactcatgagaacaaagatgaccatgagcttttgcttccaag |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1028403 |
caaaagtcaactaattttcttttgtatttacgagccagcactgatgaagtaatcgttgaactcatgagaacaaagatgaccatgagcttttgcttccaag |
1028304 |
T |
 |
| Q |
237 |
ggctaacatcgatcgtatttggtatctctg |
266 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
1028303 |
ggccaacatcgatcgtatttggtatctctg |
1028274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 60 - 139
Target Start/End: Complemental strand, 1033688 - 1033609
Alignment:
| Q |
60 |
ttccaatgaacgtcttctacacagcccttcccatagaaatgaagcagaatttggaagcagcaactgccagcaatcaccaa |
139 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1033688 |
ttccaatgaacgtcttctaccaagatcttcccacagaaatgaagcagaatttggaagcagcaactgccaggaatcaccaa |
1033609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 61 - 139
Target Start/End: Complemental strand, 4516227 - 4516149
Alignment:
| Q |
61 |
tccaatgaacgtcttctacacagcccttcccatagaaatgaagcagaatttggaagcagcaactgccagcaatcaccaa |
139 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
4516227 |
tccaatgaacgtcttctaccaagatcttcccacagaaatgaagcagaatttggaagcagcagctgccaggaatcaccaa |
4516149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 9 - 137
Target Start/End: Original strand, 50832378 - 50832502
Alignment:
| Q |
9 |
tcgtacttcagggatttcattgggtcagttccatctgccaagagttccaacttccaatgaacgtcttctacacagcccttcccatagaaatgaagca--- |
105 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||| ||||||| ||||||| |||| || ||||||| |||||||||||| |
|
|
| T |
50832378 |
tcgtacttcagcgatttcattgggtcagttccatctaccaagag-------ttccaataaacgtctcctaccaagatcttcccacagaaatgaagcagcg |
50832470 |
T |
 |
| Q |
106 |
gaatttggaagcagcaactgccagcaatcacc |
137 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| |
|
|
| T |
50832471 |
gaattcggaagcagcaactgccaggaatcacc |
50832502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University