View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11475_low_29 (Length: 270)
Name: NF11475_low_29
Description: NF11475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11475_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 4 - 150
Target Start/End: Complemental strand, 6176169 - 6176026
Alignment:
| Q |
4 |
tcatattcatcagtgtcattaccactgagtcctcctcctcctgctccaacagaagaggaagtgacatgtatagcatggtttgatctagaagttgaatcaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6176169 |
tcatattcatcagtgtcattaccactgagtcctcctcct---gctccaacagaagaggaagtgacatttatagcatggtttgatctagaagttgaatcaa |
6176073 |
T |
 |
| Q |
104 |
gggctgagatctttccatcttgaagctggttaatggatcctggcatg |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6176072 |
gggctgagatctttccatcttgaagctggttaatggatcctggcatg |
6176026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 260
Target Start/End: Complemental strand, 6175952 - 6175914
Alignment:
| Q |
221 |
tgttgttgttgttgttatgttccattttttctctctctct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6175952 |
tgttgttgttgttgttatgttccatttttt-tctctctct |
6175914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University