View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11475_low_40 (Length: 240)
Name: NF11475_low_40
Description: NF11475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11475_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 132 - 210
Target Start/End: Complemental strand, 28573350 - 28573272
Alignment:
| Q |
132 |
gaataatttaagaagatgatgaattccttttgatggggcttagtgggaaacaatcaaaagacatccgttggttctcttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28573350 |
gaataatttaagaagatgatgaattccttttgatggggcttattgggaaacaatcaaaagacatccgttggttctcttg |
28573272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 28573386 - 28573343
Alignment:
| Q |
17 |
atatcttaagtagtaagtgtctatctcaagcaagcagagtaatt |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28573386 |
atatcttaagtagtaagtgtctatctcaagcaagcagaataatt |
28573343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University