View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11475_low_41 (Length: 240)
Name: NF11475_low_41
Description: NF11475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11475_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 225
Target Start/End: Complemental strand, 24796910 - 24796699
Alignment:
| Q |
15 |
ccatttcatttcaatcgtgaagggcactcatttcatttggatgtcagtctacgaaactgttagtcaaagttgaccaaaattttc-atttaattggctttt |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24796910 |
ccattccatttcaatcgtgaagggcactcatttcatttggatgtcactctacgaaactgttggtcaaagttgaccaaaattttccatttaattggctttt |
24796811 |
T |
 |
| Q |
114 |
atcgtatcaaaattcacggttcttagtatagataacaaccatagttagataagaatcttatctaagtaccccaccaagatatacaatgttggttttattc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24796810 |
atcgtatcaaaattcacggttcttagtatagataacaaccatagttagataagaatcttatctaactaccccaccaagatatacaatgttggttttattc |
24796711 |
T |
 |
| Q |
214 |
ttgactatctct |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
24796710 |
ttgactatctct |
24796699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University